SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13760
Pre Gene Modal
BGIBMGA011529
Annotation
PREDICTED:_glutamate_receptor_ionotropic?_kainate_2-like_[Papilio_polytes]
Location in the cell
Cytoplasmic   Reliability : 1.572
 

Sequence

CDS
ATGTGGGGCACCATGGAATCCGCTCGTCCTTCGGTTTTCGTAAAGAACAACGACGAAGGCGTCGAAAGAGTACTTAAAAGCAGAAGAGGTTATGCCTATTTCATGGAATCAACTGCTATTGAATACCAGTTAGAGCGTCATTGTGAACTAATGCAGATCGGCGACCCTCTTGATTCAAAAGGATACGGAATCGCAATGCCGTTTTTCTCTTCATACCGTGGTGCCGTCGATAACGCTGTACTAAAATTAGCCGAAAGCGGGAAATTGGTGGAGATAAAAAATCGTTGGTGGAAATTGCCTCCCGAAGAAGCTTGTGTTGTTAGTTTTTAA
Protein
MWGTMESARPSVFVKNNDEGVERVLKSRRGYAYFMESTAIEYQLERHCELMQIGDPLDSKGYGIAMPFFSSYRGAVDNAVLKLAESGKLVEIKNRWWKLPPEEACVVSF

Summary

Similarity
Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family.
EMBL
BABH01015232    KZ150075    PZC73970.1    ODYU01006689    SOQ48759.1    NWSH01002576    + More
PCG67937.1    MG820698    AXF48869.1    KQ459833    KPJ19823.1    KQ459037    KPJ04257.1    RSAL01000042    RVE50833.1    AGBW02013238    OWR43841.1    ACPB03008552    GBHO01042723    JAG00881.1    GBHO01022290    GDHC01007640    JAG21314.1    JAQ10989.1    GBHO01022287    JAG21317.1    GBHO01022289    GBRD01004119    JAG21315.1    JAG61702.1    GBRD01004120    JAG61701.1    JTDY01000067    KOB79074.1    KK855412    PTY22443.1    PTY22444.1    GECU01037857    JAS69849.1    GECU01006758    JAT00949.1    DS235235    EEB13717.1    GEDC01014721    JAS22577.1    ADTU01026376    ADTU01026377    GEDC01026520    GEDC01013278    JAS10778.1    JAS24020.1    ADMH02001821    ETN61009.1    GGMR01017668    MBY30287.1    GECZ01001371    JAS68398.1    APCN01001012    APCN01001013    AAAB01008847    EAA06913.4    AXCN02001376    AXCM01004371    GGFJ01009020    MBW58161.1    GGFJ01009000    MBW58141.1    KQ976417    KYM89915.1    ATLV01025084    KE525369    KFB52144.1    GBXI01001226    JAD13066.1    KR998364    AMH85983.1    GGMS01015526    MBY84729.1    NEVH01012087    PNF30820.1    GGFL01003458    MBW67636.1    ADMH02001779    ETN61105.1    AAAB01008815    EAA05023.4    APCN01007369    CAQQ02162970    CAQQ02162971    PNF30821.1    GAKP01021897    JAC37055.1    AAZX01000424    AAZX01000429    AAZX01008541    AAZX01011194    AAZX01013279    AAZX01013570    AAZX01013893    AAZX01015619    AAZX01025922    GFDL01002185    JAV32860.1    DS233058    EDS27792.1    GFDL01002179    JAV32866.1    GDHF01018808    GDHF01006355    JAI33506.1    JAI45959.1    JXUM01110194    KQ565389    KXJ71033.1    CH477244    EAT46291.1    JXUM01094236    KQ564114    KXJ72756.1    PZC73971.1    KY817091    AVH87307.1    GGMR01017854    MBY30473.1    GFXV01008185    MBW19990.1    KY445581    AQN78516.1    EAT46290.1    MF385150    AWT23321.1    KXJ71034.1    JXUM01008704    KQ560267    KXJ83447.1    PNF30822.1    KQ976453    KYM85527.1    PNF30868.1    PNF30865.1    PNF30864.1    KK853270    KDR09166.1    GGOB01000004    MCH29400.1    GGOB01000002    MCH29398.1    CVRI01000063    CRL04875.1    KK854577    PTY17048.1   
Pfam
PF00060   Lig_chan        + More
PF00497   SBP_bac_3
PF01094   ANF_receptor
PF10613   Lig_chan-Glu_bd
Interpro
IPR001638   Solute-binding_3/MltF_N        + More
IPR001320   Iontro_rcpt       
IPR028082   Peripla_BP_I       
IPR019594   Glu/Gly-bd       
IPR001508   Iono_rcpt_met       
IPR001828   ANF_lig-bd_rcpt       
SUPFAM
SSF53822   SSF53822       
PDB
5EHS     E-value=8.12505e-29,     Score=309

Ontologies

Topology

Subcellular location
  
Length:
109
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00319
Exp number, first 60 AAs:
0.00014
Total prob of N-in:
0.21883
outside
1  -  109
 
 

Population Genetic Test Statistics

Pi
380.489757
Theta
191.779782
Tajima's D
3.096758
CLR
0
CSRT
0.982250887455627
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号