SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13758
Pre Gene Modal
BGIBMGA011528
Annotation
PREDICTED:_glutamate_receptor_ionotropic?_kainate_2_isoform_X2_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 2.316
 

Sequence

CDS
ATGAGAGGAACAAAAGTCGTTTTCCTCGTACTATTCTTTGGACACCTTTCGGCTCTTCCGGACACGATACGAATAGGTGGACTCTTTCACCCTGAAGATGATAAGCAAGAGGTTGCATTTCGTTACGCAGTTGAAAGAGTTAATGCAGACCGCACCTTACTGCCGCGAGCCAAACTATTAGCCCAAGTCGAAACGATTTCTCCGCAGGACAGTTTTCATGCTTCGAAACGAGTATGTCATCTTCTACGAAGCGGAGTTGCAGCGATATTCGGTCCTCAATCAGCACCCGCTGCCGCTCACGTCCAGTCCATATGCGACACGATGGAACTGCCCCACTTAGAAACCAGATGGGACTATCGCACACGCCGGGAATCTTGCCTCGTAAACCTTTACCCACATCCAGCTGCGCTCAGTAGGGCGTACGTAGATCTTGTTAGAGCTTGGGGTTGGAAATCTTTCACTATAGTATACGAAAATAGCGATGGGTTAGTTCGTCTGCAGGAATTGCTCAAAGCACATGGACCTTCAGAATTGCCTGTATCTGTTCGACAGCTTCCAGATTCTCATGACTATAGACCCCTTCTGAAACAAATAAAAAACTCGGCCGAGTCCCACATTGTTCTCGACTGCGCAACCGAAAGAATAAGGGATGTACTCCAACAAGCACAACAAATCGGAATGATGTCGGATTACCATAGCTACCTTATCACATCTTTGGATCTTCACAGCGTAGATTTGGAAGAGTTTAAATACGGGGGAACAAATATAACTGCTTTAAGACTGCTCGACCCGGAACGAGCAGATGTTCAATGGGTGGTGCGAGATTGGGTTTACGATGAGGCAAGAAAAGGTCGAAAATTGCAATTAGGACACACGACAGCTAAAGAAAATATGACATTTATTAAGACAGAAACAGCCTTGATGTATGACGCAGTACATTTGTTCGCGAAAGCGTTACACGATCTCGATACATCTCAGCAAATCGACGTGAGACCGCTCTCCTGTGAGGCTGAAGATACATGGCCCCATGGGTATAGCCTCATCAATTATATGAAAATCGTCGAAATGAAAGGACTAACCGGAGTTATAAAGTTCGATCACCAAGGATTTAGAAGCGATTTCACTTTAGATATAATCGAATTGACAAGGGACGGTCTCCAAAAAGCTGGAACTTGGAATTCATCTGAAGGTGTCAACTATACGAGATCTTACGGCGAGAACCAAAAACAGATAGTTGAAATTTTGCAAAATAAGACTCTTGTAGTGACAACAATTTTGAGTGCTCCGTATTGTATGAGGAAAGAAGCGAGCGAAAAGTTAACAGGCAACGCACAATTCGAGGGCTACGCAATAGATCTTATTCATGAGATATCTAAAATTCTGGGCTTCAATTATACATTCAAACTGGCTCCTGACGGTCGATACGGGTCGTACAATCGTGAAACCAAAGAATGGGATGGAATGATTAGGGAGCTTCTCGAGCAAAGAGCAGACCTTGCCATAGCAGATCTCACCATTACCTACGACAGAGAGCAAGTGGTCGATTTCACGATGCCATTCATGAACCTCGGCATTTCAGTGCTTTACCGCAAACCAATAAAACAGCCCCCGAACCTCTTCTCATTTCTTTCTCCTTTATCACTGGACGTGTGGATTTATATGGCAACTGCCTATTTAGGGGTTTCTGTGCTGCTGTTTATATTGGCAAGGTTCACTCCATACGAATGGCATCAAACGCATTCACCTGAGGGCGAAAAAATGGAGAATATTTTCTCTCTAGCAAACTGTTTGTGGTTTGCAATCGGATCTCTAATGCAACAAAGCTGTGATTTTTTGCCCAAAGCCGTTTCAACTCGCATGGTGGCCGGGATGTGGTGGTTCTTTACTTTAATCATGATATCATCTTACACTGCCAACTTGGCTGCGTTCTTAACCGTCGAGAGAATGGACTCGCCCATTGAGAGCGCAGAAGATCTCGCAAAACAAACTAAGATCAAATACGGAGCTTTGAAGGGAGGGTCAACTGCAGCATTTTTCAGGGACTCAAACTTTTCAACATACCAGCGAATGTGGTCATTCATGGAATCCGCCAGGCCATCAGTATTCGCAAATACTAACAAGGAGGGAGAAGAAAGGGTGGTGAGGGGAAAGGGCGCTTACGCTTATCTAATGGAGTCTACGACCATAGAATATGTGGTGGAAAGGAACTGTGATCTAACGCAAGTCGGAGGGATGCTCGACTCTAAAGGATATGGAATTGCTATGCCACCAAACTCGCCGTATCGCACAGCCATAAGCGGGGCTGTTTTGAAGCTTCAAGAAGAAGGAAAATTGCACATTCTCAAAACGAAATGGTGGAAGGAAAAACGCGGTGGAGGTTCATGCAGGGATGAAACTTCCAAGTCCTCGTCAACTGCAAACGAGCTAGGTCTAGCCAACGTGGGTGGAGTTTTCGTTGTCCTCATGGGAGGAATGGGAGTAGCATGCGTGATCGCGGTTTGCGAATTCGTATGGAAGTCACGTAAAGTAGCCGTCGATGAACGGAAAGAGGAGGCGTCACTATGCTCGGAGATGGCGTCTGAATTGCGTTCGGCGCTCAAGTGCCCTGGTAGCGCGGGTGGGGGCAGTGGCAGCGGGGCAGCGCGGGATGGCGCGGGTTCCCCATACCTTCACTACGGGTTCAGTACAAAGAGCCAACTCCACTAG
Protein
MRGTKVVFLVLFFGHLSALPDTIRIGGLFHPEDDKQEVAFRYAVERVNADRTLLPRAKLLAQVETISPQDSFHASKRVCHLLRSGVAAIFGPQSAPAAAHVQSICDTMELPHLETRWDYRTRRESCLVNLYPHPAALSRAYVDLVRAWGWKSFTIVYENSDGLVRLQELLKAHGPSELPVSVRQLPDSHDYRPLLKQIKNSAESHIVLDCATERIRDVLQQAQQIGMMSDYHSYLITSLDLHSVDLEEFKYGGTNITALRLLDPERADVQWVVRDWVYDEARKGRKLQLGHTTAKENMTFIKTETALMYDAVHLFAKALHDLDTSQQIDVRPLSCEAEDTWPHGYSLINYMKIVEMKGLTGVIKFDHQGFRSDFTLDIIELTRDGLQKAGTWNSSEGVNYTRSYGENQKQIVEILQNKTLVVTTILSAPYCMRKEASEKLTGNAQFEGYAIDLIHEISKILGFNYTFKLAPDGRYGSYNRETKEWDGMIRELLEQRADLAIADLTITYDREQVVDFTMPFMNLGISVLYRKPIKQPPNLFSFLSPLSLDVWIYMATAYLGVSVLLFILARFTPYEWHQTHSPEGEKMENIFSLANCLWFAIGSLMQQSCDFLPKAVSTRMVAGMWWFFTLIMISSYTANLAAFLTVERMDSPIESAEDLAKQTKIKYGALKGGSTAAFFRDSNFSTYQRMWSFMESARPSVFANTNKEGEERVVRGKGAYAYLMESTTIEYVVERNCDLTQVGGMLDSKGYGIAMPPNSPYRTAISGAVLKLQEEGKLHILKTKWWKEKRGGGSCRDETSKSSSTANELGLANVGGVFVVLMGGMGVACVIAVCEFVWKSRKVAVDERKEEASLCSEMASELRSALKCPGSAGGGSGSGAARDGAGSPYLHYGFSTKSQLH

Summary

Similarity
Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family.
EMBL
MG820669    AXF48840.1    ODYU01008610    SOQ52341.1    KQ459037    KPJ04255.1    + More
LC017781    BAR64795.1    RSAL01000042    RVE50836.1    JTDY01000347    KOB77595.1    KF768733    AIG51927.1    NWSH01002576    PCG67936.1    KY283580    AST36240.1    KQ459833    KPJ19821.1    BABH01015229    GDKB01000032    JAP38464.1    NEVH01012087    PNF30870.1    PNF30867.1    PNF30869.1    AAAB01008847    KP843209    ALD51346.1    ADTU01017309    ADTU01017310    ADTU01017311    ADTU01017312    ADTU01017313    ADTU01017314    ADTU01017315    ADTU01017316    ADTU01017317    ADTU01017318    QOIP01000002    RLU25960.1    APCN01001007    APCN01001008    APCN01001009    APCN01001010    APCN01001011    APCN01001012    KQ971312    KYB29342.1    EAA06836.6    ATLV01025088    ATLV01025089    ATLV01025090    ATLV01025091    ATLV01025092    KE525369    KFB52145.1    GGFJ01001924    MBW51065.1    EGK96607.1    PCG67935.1    GEZM01076945    JAV63525.1    KYB29343.1    GBBI01002254    JAC16458.1    ACPB03008552    KQ980334    KYN16523.1    KQ981523    KYN40142.1    KQ976885    KYN07450.1    CH940650    EDW67656.1    CH916374    EDV91121.1    CH933806    EDW16574.1    CH964251    EDW83135.1    AE014297    AAF55818.1    CM000160    EDW96192.1    CH902617    EDV42454.2    CH480842    EDW49604.1    CH954181    EDV48327.1    AY119103    AAM50963.1    OUUW01000013    SPP87746.1    CH479179    EDW24695.1    CM000070    EAL27760.2    KA645514    AFP60143.1    GAMC01010282    JAB96273.1    GDHF01028684    JAI23630.1    GBXI01000618    JAD13674.1    ABLF02032802    ABLF02032813    ABLF02032814    ABLF02032817    CP012526    ALC46719.1    JXJN01004815    JXJN01004816    GFXV01005416    MBW17221.1    CCAG010014365    CM000364    EDX12165.1    JRES01001168    KNC24884.1    KK854577    PTY17047.1    KK107250    EZA54440.1    GAKP01007921    JAC51031.1    PTY17048.1    GFXV01001172    MBW12977.1    DS235846    EEB18532.1    KQ976530    KYM81659.1    KX016774    APF30023.1    DS235235    EEB13717.1    GGMS01000159    MBY69362.1    GDIP01167678    GDIP01142972    GDIP01107730    GDIP01059632    LRGB01000848    JAL95984.1    KZS15806.1    GDIP01013465    JAM90250.1    GL732523    EFX90374.1    GDIP01061478    JAM42237.1    GDIQ01035005    JAN59732.1    GDIP01079329    JAM24386.1    GDIP01230363    JAI93038.1    AXCN02001376    AXCM01004371   
Pfam
PF01094   ANF_receptor        + More
PF00060   Lig_chan
PF10613   Lig_chan-Glu_bd
Interpro
IPR019594   Glu/Gly-bd        + More
IPR001320   Iontro_rcpt       
IPR028082   Peripla_BP_I       
IPR001508   Iono_rcpt_met       
IPR001828   ANF_lig-bd_rcpt       
SUPFAM
SSF53822   SSF53822       
PDB
5KUF     E-value=0,     Score=2069

Ontologies

Topology

Subcellular location
  
SignalP
Position:   1 - 18,         Likelihood:  0.982933
 
 
Length:
901
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
78.6203000000002
Exp number, first 60 AAs:
3.77324
Total prob of N-in:
0.18464
outside
1  -  549
TMhelix
550  -  569
inside
570  -  623
TMhelix
624  -  646
outside
647  -  815
TMhelix
816  -  838
inside
839  -  901
 
 

Population Genetic Test Statistics

Pi
229.693628
Theta
190.020616
Tajima's D
0.714996
CLR
0.178828
CSRT
0.575821208939553
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号