SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13743
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.666
 

Sequence

CDS
ATGGCAATCCATCTACCATCTGGATGCCACATGCAGGCCTACGCAGACGATGTGGTACTCGTGGTCACCGCCGAAAATGTCAATCGCCTAGAGGAGCTCACCGACACGGTTCTCCAACAGATAGTGAATTGGGGAAAAAGCGTCAAGCTCGAATTCGGGGCCTTCAAAACACAACTGATCGCCTTCACCCCCAAGGCCAGAACTCTTAGGGTGGAGATGGACGGTCAAATCTTAAAAACCTGTAAGGAGATCAAGCTCCTCGGAATAATTTTGGACGAAAAGCTGCTCTTTGGCCGCCATGTACAGTACGTCCTGGGAAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACCTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTTCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACTATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTACATAGATTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCGCACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTTAACAAATGCACACAAACAAACTTTCAGCATACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACCTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGCGTTCGCTGCGAAAAGGCACAGTCACGAAGAAACGTGCCACGCAGTACAGGTGCCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACCTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MAIHLPSGCHMQAYADDVVLVVTAENVNRLEELTDTVLQQIVNWGKSVKLEFGAFKTQLIAFTPKARTLRVEMDGQILKTCKEIKLLGIILDEKLLFGRHVQYVLGKASRIFNKLCLYSRPTWGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFTPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIYIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIRTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQHTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQAFAAKRHSHEETCHAVQVPPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

EMBL
RSAL01000249    RVE43511.1    AB046668    BAB21511.1    AB211537    BAE44464.1    + More
D38414    BAA07467.1    NCKU01007943    RWS02258.1    NWSH01001820    PCG70022.1    GFAH01000444    JAV47945.1    KZ149985    PZC75691.1    IAAA01038678    LAA08500.1    GFTR01008639    JAW07787.1    KK114278    KFM62077.1    GEGO01004274    JAR91130.1    MUJZ01028333    OTF78340.1    KP771711    AKU04648.1    KK115566    KFM65430.1    KP771712    AKU04650.1    KK119855    KFM76920.1    KK115320    KFM64783.1    GDAI01000743    JAI16860.1    KK121445    KFM80483.1    GEFM01006379    JAP69417.1    AF015813    AAB94039.1    GACK01003634    JAA61400.1    GECZ01013919    JAS55850.1    KU543676    AMS38357.1    GBBI01004920    JAC13792.1    AF015489    AAB94030.1    KK116791    KFM68755.1    GEFM01006389    JAP69407.1    GEFM01002205    JAP73591.1    GEFM01005915    JAP69881.1    U73803    AAB92394.1    GANO01003496    JAB56375.1    GANO01003537    JAB56334.1    PABS01000003    MAT33547.1    GANO01003141    JAB56730.1    GFTR01008541    JAW07885.1    GFTR01008411    JAW08015.1    KU543680    AMS38365.1    CR848788    GANO01003539    JAB56332.1    GANO01003538    JAB56333.1    GGLE01001887    MBY06013.1    GAPW01000103    JAC13495.1    KU543677    AMS38359.1    AAZX01016607    AAZX01023407    GDAI01000751    JAI16852.1    GDAI01000752    JAI16851.1    RSAL01000438    RVE41707.1    AAZX01002319    LBMM01010475    KMQ87436.1    IACF01002963    LAB68595.1    GECZ01028519    JAS41250.1    U87543    AAB65093.1    GDAI01000756    JAI16847.1    KU543672    AMS38350.1    GANO01003611    JAB56260.1    GANO01003612    JAB56259.1    GG672330    EER17156.1    GANO01003746    JAB56125.1    ABLF02060681    ABLF02064366    ABLF02030052    GGMS01012395    MBY81598.1    JQGA01001155    KGO69287.1    MNAD01000345    OJT13951.1    GFTR01008431    JAW07995.1    AZST01001167    KEP46314.1    JATN01000319    EUC61565.1    X59239    CAA41925.1    LNIX01000015    OXA46641.1    GGMS01001879    MBY71082.1    CAOJ01012627    LN679168    CCO34112.1    CEL62418.1    HG793200    CRL30999.1    GANO01003536    JAB56335.1    MNBE01000390    MNBE01000261    OKP10147.1    OKP11873.1   
Pfam
PF00075   RNase_H        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
PF16012   DUF4780
PF00098   zf-CCHC
PF13966   zf-RVT
Interpro
IPR036397   RNaseH_sf        + More
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR031961   DUF4780       
IPR004808   AP_endonuc_1       
IPR001878   Znf_CCHC       
IPR026960   RVT-Znf       
SUPFAM
SSF53098   SSF53098        + More
SSF56219   SSF56219       
Gene 3D
PDB
2QKK     E-value=5.76573e-05,     Score=112

Ontologies

Topology

Length:
551
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.02183
Exp number, first 60 AAs:
0.00029
Total prob of N-in:
0.01258
outside
1  -  551
 
 

Population Genetic Test Statistics

Pi
197.512959
Theta
169.476642
Tajima's D
0.346857
CLR
303.603018
CSRT
0.467776611169442
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号