SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13688
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.986
 

Sequence

CDS
ATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTCTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTTTCTCGGAGCGCGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCTGAATGGGGTAAATTGAACTTGGTTCAATTCAACCCTATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTACAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTCGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACTGCCCGCCACCGGAATAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACACACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGGTCAATGGCCTTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCGGGGCGTGGCGCATCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCCCATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGTTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCATTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGCCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGTCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSAVQERRSKLVSEVENSLGRVSEWGKLNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRNRVHPYYLEPLRSSTHLVPRLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVAHPSPSVVRARRAQSRRSVLESWSRRLAHPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECYHCGCDLDTAEHTLIACPAWEGWRRVLAAKIGNDLSLPSVVASMLGNDESWKAMLDFCECTISQKEAAGRVRDAQVRRRRAGAREADLALALAL

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
560
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.730159999999998
Exp number, first 60 AAs:
0.59979
Total prob of N-in:
0.03217
outside
1  -  560
 
 

Population Genetic Test Statistics

Pi
197.340618
Theta
170.58282
Tajima's D
1.174829
CLR
0.476733
CSRT
0.708864556772161
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号