SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13687
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.515
 

Sequence

CDS
ATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGCTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATTGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGAGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATCCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTTCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCTCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATTCTAGGACGTCTCTATCCGATGATATGTAGGAGAAGTAAAATGTCCCTTAGAAATAAGGTGACACACACTCTACAAAACTTGCATACGCAACGTCATGACCTATGCAAGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCACCAGTAAGTATATGCAGTCGGCGTCAATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTCTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQEHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGFALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTSAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTHTLQNLHTQRHDLCKIAVGAPWFVRNVDLHDDLDLESTSKYMQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    AF081103    AAC72921.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    ABLF02014862    ABLF02014866    ABLF02061908    KK117880    KFM71667.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    ABLF02008933    ABLF02042518    ABLF02057746    GGMS01000737    MBY69940.1    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    GEZM01038405    JAV81653.1    GBBI01004395    JAC14317.1    ABLF02033757    GGMS01008766    MBY77969.1    GGMR01003407    MBY16026.1    NEVH01007393    PNF35987.1    NEVH01012089    PNF30491.1    NEVH01007578    PNF35646.1    GGMR01016114    MBY28733.1    NEVH01006736    PNF36716.1    GBBI01001646    JAC17066.1    KQ973412    EFA12510.2    GGMR01000676    MBY13295.1    GGMS01004685    MBY73888.1    GFXV01007093    MBW18898.1    GEZM01053022    JAV74219.1    LBMM01010106    KMQ87671.1    KQ973073    KXZ75680.1    GGMR01018716    MBY31335.1    NEVH01023961    PNF17613.1    NEVH01010546    PNF32261.1    NEVH01001355    PNF42855.1    NEVH01020071    PNF21969.1    NEVH01000280    PNF43672.1    NEVH01003017    PNF40781.1    NEVH01005938    PNF38077.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    RPOV01000134    RPJ78669.1    NEVH01006721    PNF37225.1    ABLF02020655    ABLF02039168    ABLF02061060    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01006408    MBY19027.1    GGMR01012305    MBY24924.1    NEVH01019964    PNF22161.1    GGMS01002992    MBY72195.1    GGMS01004444    MBY73647.1    NEVH01019080    PNF22876.1    NWSH01000032    PCG80497.1    NEVH01026386    PNF14434.1    GFXV01006424    MBW18229.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    GFTR01008251    JAW08175.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    GGMS01012005    MBY81208.1    NEVH01014858    PNF27387.1    GGMS01017365    MBY86568.1    NEVH01020940    PNF20481.1    NEVH01002716    PNF41415.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01016302    PNF25823.1    GFTR01008271    JAW08155.1    NEVH01011985    PNF31054.1    NEVH01026154    PNF14491.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    KK855204    PTY21424.1    NEVH01002704    PNF41489.1    NEVH01019376    PNF22596.1    ABLF02008463    NEVH01000269    PNF43694.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
PF13358   DDE_3
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR038717   Tc1-like_DDE_dom       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.0044979,     Score=96

Ontologies

Topology

Length:
559
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.708619999999997
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01792
outside
1  -  559
 
 

Population Genetic Test Statistics

Pi
19.502523
Theta
32.301801
Tajima's D
1.623091
CLR
0.049758
CSRT
0.816059197040148
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号