SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13685
Pre Gene Modal
BGIBMGA002306
Annotation
hypothetical_protein_[Escherichia_coli]
Location in the cell
Nuclear   Reliability : 4.527
 

Sequence

CDS
ATGATGACTCGCAGCATCAAATCTCGTCAGGTTGATGAACAGCTTCGTATTGCTTTAGAACAATTAAAAAATATTCGCGAAAAATATGATATACTTTTACAAGAAAGTGAACAAAATGAAGAGGAGATGCTGTCAGTCATCTCTAAGAATACTGACCTTAAAAAACAATTGTCTCAGCTCTTCATTGAACACAGTGAAGCTCTTGAGATCAATCAGAAGTTGCAGGATACGATTAACACCTTTTCTCAATGCAGTGATGAATTTTGTGATTCATTGAAAATCACTGCTCAGTTGAGACATAAATTGGCTGAGGCTGATGATTGTATTTCTGACTTGCGGTCAGAGTTATGTAAACTTAAGGAACAGCAGCCTCAGAGCTTATATTCGGAACTGGTTCAGAGCGAACCCTCTTTGGTTGCTGTAGATACTGCCTTGAATTTTGACATAACTACTATTGATCTGACTGGTAGTGATGCAGAGACCTCAGAGCGCTCCCAGTTAGTTTTAAGTAAAAATAAACTTAGGAAATATGTTAAAATTAATAAATTAATATATAAGACTCAACGGAAATTGAGGAATTACAAGTCTCAGGAATACATCAAGTTCATTTGCAAGCAGAGAACTTCACTTTCACACCAGGTAGCTGTATTGACTGAACAGAGTCAACAAATTCATCACAAACACATGGAAGAAATAGAATGTTTATCTACACAAATAAACAATTTAAAGTCAAGTTTAGAGAACATTACATTAAACTATGAACTAGCACAGAGGGACATTAGTGAGCATGTGTTGGCAATGGACAATTTAATTGATACTTGTAATTATAATCAACAGCGTTTTGACTCTTTGACAATGCAGTACGCTGAATGTAAATGCTCTGCATCGGGTTGTCAGGAGCTACCACATGTTGAAATTCAAAAACATAATGTGTCTATTCTTTCAGTGCTAGAGTCTCAAAGCAATGATATTATGAGGGCAGCACCTATCTGTCTACCTACTACTGCATCTTCACAAGTTTCTAGAGAAGACAAAATTAAAATAAAAATTTTTAGTGATGAGCTGGGGAAACAAATGGGTGTGGCATTACATGACCTTTGTTTTGGACAACATGAATCATTGGAGCTTGTTGAGTCAACCGTATTTCTTGGTATAACAGTGGACTCCAAACTGCAGTGGGGACCTCATATTCATAAATTGGCGAGTAAGCTCAGCTCTGCAGCATACGCAGTAAAAAAAATTAGAATGTTAACAAACGCGGACACGGCTCGTTTAGTTTACTTTAGTTACTTCCACAGTGTCATGTCCTATGGCATTTTGCTATGGGGCAATGCGGCCGATGTAGAAATGATATTTATTCTGCAGAAAAGAGCTATACGTGCTATTTATAACATGCACTCAAGGGAATCCCTGAGGGAGAAATTTAAAGAAATTAAAGTTCTCACTATGCCATCCCAGTACATTTTTGAAAATTTGATGTATGTTCGTAAACATATTGAGGAGTTTCCTAAACAGTCGGACATACATAATAGAAATACTAGGAACAAACACAAGCTTGTTGTGCCGATGAGTAGGTTACATAAGATACGAAATTCATTCGGGTGTTTGTCTGTGCGCCTGTACAACAAAATCCCACATGATGTTCAGAACCTACATATACATAGGTTTAAGAAAACTATTAAAGAACATCTGTGCAATAAAGCTTACTATAAAGTCAATGATTATCTAGAAGATTGCACAAAGTGGGAATGA
Protein
MMTRSIKSRQVDEQLRIALEQLKNIREKYDILLQESEQNEEEMLSVISKNTDLKKQLSQLFIEHSEALEINQKLQDTINTFSQCSDEFCDSLKITAQLRHKLAEADDCISDLRSELCKLKEQQPQSLYSELVQSEPSLVAVDTALNFDITTIDLTGSDAETSERSQLVLSKNKLRKYVKINKLIYKTQRKLRNYKSQEYIKFICKQRTSLSHQVAVLTEQSQQIHHKHMEEIECLSTQINNLKSSLENITLNYELAQRDISEHVLAMDNLIDTCNYNQQRFDSLTMQYAECKCSASGCQELPHVEIQKHNVSILSVLESQSNDIMRAAPICLPTTASSQVSREDKIKIKIFSDELGKQMGVALHDLCFGQHESLELVESTVFLGITVDSKLQWGPHIHKLASKLSSAAYAVKKIRMLTNADTARLVYFSYFHSVMSYGILLWGNAADVEMIFILQKRAIRAIYNMHSRESLREKFKEIKVLTMPSQYIFENLMYVRKHIEEFPKQSDIHNRNTRNKHKLVVPMSRLHKIRNSFGCLSVRLYNKIPHDVQNLHIHRFKKTIKEHLCNKAYYKVNDYLEDCTKWE

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
583
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.17583
Exp number, first 60 AAs:
0
Total prob of N-in:
0.32670
outside
1  -  583
 
 

Population Genetic Test Statistics

Pi
114.390663
Theta
26.985664
Tajima's D
1.668249
CLR
0.525898
CSRT
0.830408479576021
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号