SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13680
Annotation
PREDICTED:_uncharacterized_protein_LOC105385758_[Plutella_xylostella]
Location in the cell
PlasmaMembrane   Reliability : 1.362
 

Sequence

CDS
ATGGTGGCCGAGGAACTTAAAAAAAACATTGATCAAGTTTTGCATGACAATAATGTCACAAGTTGGGAGGATCTTTTATCATTTGCATATAGAATTTTGCATGTAGATAAACAGAGCAATAACTCCCATTCACTTACTAAAAAAATTAAGGATAATTGTAAGAATAATTCCAATAAGACTTTGTTGGACGATGGGGTAAATTATGACAAGCAACAGCGTCCATTTAATAAAGTTGCAAAAATTGAGGGGAAAGTAAGTGATGGAGATTTAAAGGGTGCCTCACAACTATTATTTTCATCAGATTCTCTAGCTCCGAATAATGCCGACACTCTTCTGGCGTTGAAGTCGAAACATCCTGCACCTTTAACACCTGTTAGTGTGCCGCCACCACAGTCTTCCACAACTTTGCCTCGTGTGTCTCTTGATGACGTTCTCACCACAATTACATCTTTTAAAAACGGTTCAGCAGCCGGACTGGATGGTCTATCCCCGCAGCATTTCAAGGATTTAATCAATGTTTCTGCTGGTGATGTCGGGCGGTCTTTACTTAAAAGTATAGTCTCGCTTGTTAATTTAATGCTGGCGGGAAGTGTACCTGAAAGTATCGCTGATATTTTGTATGGAGCGAATTTGTGTGCTTTGATGAAGAGAGATGGCGGTATTAGGCCTATCGCTGTTGGCGGTACACTGCGCCGCATTGTATCCAGGCTTTGCTGCAAAGAGGTTCTGCCGATATTGAGTGGGATGTTCCGGCCGATACAGTTGGGCGTCGGTACAAAGGGCGGCTGTGAAGCTGCGGTACATGCGGCTCGCACCTTTCTTAAGGGGGGTGGTGCCGAAGTATTGGTGAAGGTGGATTTAAAAAATGCATTTAATTGTATCGATAGGAATGCTTTTCTCAAAGAAGTGAAGGAACACATACCATCTATCTACCCTTACCTTTATCAATGCTATGGTAATCCATCTAAGCTGGTTTATAAGGAGAACCTTGTGGAATCAGCGACGGGTTGTCAACAAGGTGATCCACTCGGTCCGGCGATTTTTAGTTTGGGGATACATCCAGTTTTGAGGGAGCTGAAGTCCAGCCTAAATTTATGGTATCTGGATGACGGAACATTGGGAGGGGACATTTCCACGGTCTTAAGGGATTTAGAATATCTAAAATCTGCTTTGGCCAGTTTGGGTTTAGAGCTCAATTTTGCTAAGTGTGAGCTTTTTATCAATGCCTCTTGTTGTTCCGTACCAGTTTCTGACGTTTTTGCAAAGTTTAATACAGCAGCGCCCAACATAAAAATTGTTGATGAGAATTCTCTGATGTTGCTGGGTGCTCCCATTTTGGATGGATCGATCGACGCGTATATTGATGAGCAGATTGATAAATTTTCTCAGTGTTCCAACAATTTATTTGAAATTAACTCTCATATGGCTTTGTTCATCATAAGACACTGTCTATTCGTACCTAAATTTACATATGTGTTAAGATGTTCTTTCTTATGGAAACATAATAATAAACTTAATTCTTTGGATGAAATGATAAAAGGTGTTCTGTGCAAAATAATTAATTGTAATTTGGGTGACCTCTCTTGGGAGCAATGTGTCCTGCCGGTACGTTTTGGTGGTATCGGCGTACGTAAAGCATCAGCTGTTGCATTGCCGGCCTTTCTTGCTTCTGCACACGCCTCCTGTCTCATAGTCGGTAATGTTCTCAACCCTTGTATGGGTTCCGTAGAGATTGTGGGTGTGTCGGAGGCTGGATCGGCCTGGCAGTCTTTGTGTCAGGCGGATTTTCCTACTTTACCGCATTTGCAGCGTCTTTGGGACACTCCGCTTTGTCAACGGATACAGCAACGGTTACTACAGTCATATGACAACAGCGTGGACATTGCTCGTTTTCGCGCCGTTACCGAAAAGGAATCAAGTTACTGGCTTCAAGCCTATCCATCGTCCAATACAGGCACGTTGTTGGACAACAACGCTCTCTCGCTAGCTATTGGCTTACGGTTGGGGGCCCATATTAACGTACCACATTTCTGTGTCTGTGGCGAGTACGTCAATGAGCTTGGACATCACGGACTCTCGTGCCAGAAAAGCGCTGGGCGCATTCCAAGACACGCGTCTTTAAATGATATGATAAGAAGGGCGCTCACTACAATCAATGTTCCGGCTGTCTTGGAACCCATCGGAATTTTGAGGTCAGATGGGAAAAGGCCCGATGGAGTCACGCTGATTCCATGGTCAGTTGGTAGGTGCCTGGTATGGGATGCTACTTGTGTGGATACTGTGGCTCCCTGTCATTTAGATGGTACTTCGTCCCGCCCCGGTTCAGCTGCAGCTTCAGCAGAAATTACAAAAAAGCGGAAGTATTCGGGTTTGGGGTCTTCTTATTCTTTTTTGCCTTTCGCGGTTGAGACGATGGGCCCTTGGGGCCCTGAAGCAAAGAAATTTTTTACAGAAATCTCCAAACGCTTGAAGGAGGTTACACATGATGCTAAGGCTGGCTGGTACTTTGCACAGAGAGTGAGTCTGGCTGTCCAACGAGGCAACGTAGCCAGTATCTTGGGGACTGTGCCTCCTTCAAGCGCGTTGGAAGATCTGTTCTACTGTGTGGGTTGA
Protein
MVAEELKKNIDQVLHDNNVTSWEDLLSFAYRILHVDKQSNNSHSLTKKIKDNCKNNSNKTLLDDGVNYDKQQRPFNKVAKIEGKVSDGDLKGASQLLFSSDSLAPNNADTLLALKSKHPAPLTPVSVPPPQSSTTLPRVSLDDVLTTITSFKNGSAAGLDGLSPQHFKDLINVSAGDVGRSLLKSIVSLVNLMLAGSVPESIADILYGANLCALMKRDGGIRPIAVGGTLRRIVSRLCCKEVLPILSGMFRPIQLGVGTKGGCEAAVHAARTFLKGGGAEVLVKVDLKNAFNCIDRNAFLKEVKEHIPSIYPYLYQCYGNPSKLVYKENLVESATGCQQGDPLGPAIFSLGIHPVLRELKSSLNLWYLDDGTLGGDISTVLRDLEYLKSALASLGLELNFAKCELFINASCCSVPVSDVFAKFNTAAPNIKIVDENSLMLLGAPILDGSIDAYIDEQIDKFSQCSNNLFEINSHMALFIIRHCLFVPKFTYVLRCSFLWKHNNKLNSLDEMIKGVLCKIINCNLGDLSWEQCVLPVRFGGIGVRKASAVALPAFLASAHASCLIVGNVLNPCMGSVEIVGVSEAGSAWQSLCQADFPTLPHLQRLWDTPLCQRIQQRLLQSYDNSVDIARFRAVTEKESSYWLQAYPSSNTGTLLDNNALSLAIGLRLGAHINVPHFCVCGEYVNELGHHGLSCQKSAGRIPRHASLNDMIRRALTTINVPAVLEPIGILRSDGKRPDGVTLIPWSVGRCLVWDATCVDTVAPCHLDGTSSRPGSAAASAEITKKRKYSGLGSSYSFLPFAVETMGPWGPEAKKFFTEISKRLKEVTHDAKAGWYFAQRVSLAVQRGNVASILGTVPPSSALEDLFYCVG

Summary

Similarity
Belongs to the amiloride-sensitive sodium channel (TC 1.A.6) family.
Pfam
PF00628   PHD        + More
PF00078   RVT_1
PF02257   RFX_DNA_binding
PF00858   ASC
PF03184   DDE_1
PF00096   zf-C2H2
PF13966   zf-RVT
Interpro
IPR036388   WH-like_DNA-bd_sf        + More
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR000477   RT_dom       
IPR019786   Zinc_finger_PHD-type_CS       
IPR003150   DNA-bd_RFX       
IPR036390   WH_DNA-bd_sf       
IPR001873   ENaC       
IPR004875   DDE_SF_endonuclease_dom       
IPR020903   ENaC_CS       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR004263   Exostosin       
IPR026960   RVT-Znf       
SUPFAM
SSF57903   SSF57903        + More
SSF46785   SSF46785       
SSF57667   SSF57667       
Gene 3D
PDB
6AR3     E-value=0.00963101,     Score=95

Ontologies

Topology

Length:
870
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.22346
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00371
outside
1  -  870
 
 

Population Genetic Test Statistics

Pi
3.052054
Theta
14.191278
Tajima's D
1.733369
CLR
167.181643
CSRT
0.844057797110145
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号