SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13678
Annotation
THAP_domain-containing_protein_9?_partial_[Camponotus_floridanus]
Location in the cell
Mitochondrial   Reliability : 2.3 Nuclear   Reliability : 1.706
 

Sequence

CDS
ATGCAAATCAGAAGGCTTCAAAAGAAAACCAGCCGTTATCAGAAAAAAATTGCTAATTTAAAGGACATTTTGAAAAACCTTAATGAAAAAAACTTCATTAGTGCTGATCACGTTACGCAATTAGAAAACATTGGAGTAACCGACCTTATCCAGCGTTATGAAAGAAATGTTTCATCGGGTCAAAGTACTAACCAGAAATATCCGCCTGCTTTAAGAATTTTTGCCACTACTCTTCACTTTTATTCGCCAAAGGCGTACGCGTATGTAAGAAAAAAATTCCAAACAGCTTTGCCTCATATTCGAACCATAAAAAAGTGGTACCAATCTATCGATGCTCAGCCTGGATTCACGCAAGAATCATTAAAAGCGATAAAACTTAAAACTGCCTGCACTAAACACAAATTGTTGTGTAATTTAGTTTTAGATGAAATGGCAATCAGACAGCATGTAGAGTGGGATGGAAAACAAATGCACGGGTATGTTGATATTTCTAATTCTGCAGAACAAGGGGATTGTTTACCCGAAGCCAAAGAAGTTCTTGTATTTTTAGTTACCGCAATTAATGGGGCTTGGAAAATACCAGTCGGGTATTTTCTCATTGACGGTGTCACAGGAGAACAACGGTCTAATCTTGTCAGACAATGTTTGGAATTATTAGAAGATACAGGTATTCAAGTTACCTCGATGACTTTTGACGGCTGTCCAGCCAATATCACCATGGCTAAGAAACTCGGATGTTCTTTTGAAGTTGAAAACTTAAAATCATATTTTGAGCACCCCGTTACTCGTCAACCTGTACATATTTTTCTCGATCCATGCCACATGCTGAAGCTATTGAGAAATGCTTTTGAATCATATGGATGTTTCATGGATGCTTCAAATAGGTGTATAAAATGGAGTCATCTAAAAAATCTGTATGACATTCAGGATAAAGAAAAACTGCACTTAGCAAATAAATTACGAAAAAGTCATATCTTTTTCAAGAACCAAAAAATGAAAGTTCGCTTAGCTTCGCAATTATTTAGCAACAGTGTTGCAGATGCCCTGAATTTTTGTTGTGAACTTCAAATCGCTGGTTTTGATGATGTAGAAGGCACTGTGGAATATCTAAAAACTATCAACAACTTGTTCGATGTGTTAAATTCAAGGCATATGGCCCAACTCCATTATAAAAAACCAGTTTGCCCAGGCAACAAAGACAAGGTATTTGAAACTTTAGAAAAGGCGAAACGGTGTCTAACATCTATAAAGCTTTCAGATGGTACAAAAGCTATCATTACACCCAGAAAAACCGGTTTTATTGGTTTATTAGTGTGCATAGAAAGCCTCAAGGCCTTGTATATACAACTAATTGAAAAGGACCAAAAACTTAAGTACATTCCGGCTTACAAAATCAGCCAAGATCATTTAGAGCTTATGTTTGGACATATACGGTCACATGGTGGATGCAGCACCAACCCAACGGCGCGACAGTTTCAAGCAATATATAAAAAGCTCTTGGTAAAGTCGGAGCTTAGAGATGTAGACCAGGGAAACTGTATAGCTCTTGAGGAGGTTTCTTTTTTGTCGTGCTCTTCAGCTGTCCAAAATATAAATCTGACAATCTAA
Protein
MQIRRLQKKTSRYQKKIANLKDILKNLNEKNFISADHVTQLENIGVTDLIQRYERNVSSGQSTNQKYPPALRIFATTLHFYSPKAYAYVRKKFQTALPHIRTIKKWYQSIDAQPGFTQESLKAIKLKTACTKHKLLCNLVLDEMAIRQHVEWDGKQMHGYVDISNSAEQGDCLPEAKEVLVFLVTAINGAWKIPVGYFLIDGVTGEQRSNLVRQCLELLEDTGIQVTSMTFDGCPANITMAKKLGCSFEVENLKSYFEHPVTRQPVHIFLDPCHMLKLLRNAFESYGCFMDASNRCIKWSHLKNLYDIQDKEKLHLANKLRKSHIFFKNQKMKVRLASQLFSNSVADALNFCCELQIAGFDDVEGTVEYLKTINNLFDVLNSRHMAQLHYKKPVCPGNKDKVFETLEKAKRCLTSIKLSDGTKAIITPRKTGFIGLLVCIESLKALYIQLIEKDQKLKYIPAYKISQDHLELMFGHIRSHGGCSTNPTARQFQAIYKKLLVKSELRDVDQGNCIALEEVSFLSCSSAVQNINLTI

Summary

EMBL
ODYU01003321    SOQ41917.1    GEZM01099613    GEZM01099610    GEZM01099604    GEZM01099599    + More
JAV53268.1    GEZM01099608    GEZM01099605    JAV53264.1    GEZM01099609    JAV53257.1    GL441823    EFN64217.1    GEZM01077470    JAV63295.1    ABLF02011460    ABLF02033413    GGLE01001112    MBY05238.1    ABLF02007004    ABLF02007005    ABLF02008523    ABLF02012848    ABLF02012849    ABLF02012851    GEZM01031190    GEZM01031189    GEZM01031180    JAV84979.1    GEZM01031195    GEZM01031187    GEZM01031186    GEZM01031184    GEZM01031182    GEZM01031181    JAV84992.1    KQ977321    KYN03587.1    KQ977365    KYN03296.1    NWSH01000621    PCG75234.1    ABLF02038040    ABLF02065516    RSAL01000057    RVE49849.1    ABLF02016100    GGMR01014547    MBY27166.1    KQ982672    KYQ52446.1    GGMR01004395    MBY17014.1    GGMR01018395    MBY31014.1    ABLF02016252    NWSH01001223    PCG72048.1    ABLF02011489    ABLF02009662    ABLF02031649    ABLF02031650    GFAC01001507    JAT97681.1    ABLF02016193    KK107641    EZA48371.1    GCES01153042    JAQ33280.1    HADY01024360    SBP62845.1    HAEJ01000494    SBS40951.1    AERX01031390    ABLF02033156    ABLF02003302    KQ979651    KYN20001.1    HAAD01001124    CDG67356.1    ABLF02013367    ABLF02015440    ABLF02057211    ABLF02009087    HADZ01019172    SBP83113.1    ABLF02015114    ABLF02008676    ABLF02008677    KQ980094    KYN17778.1    GGMR01015195    MBY27814.1    ABLF02015299    GEZM01060283    JAV71121.1    HAEA01002407    SBQ30887.1    ABLF02003891    ABLF02003892    ABLF02003893    ABLF02003894    ABLF02014815    ABLF02014817    ABLF02066539    ABLF02019247    ABLF02019254    ABLF02032544    ABLF02032554    ABLF02056709    ABLF02067302    ABLF02042324    ABLF02062307    ABLF02067566    KQ981062    KQ980795    KYN09968.1    KYN13021.1    KQ977081    KYN05929.1    GL437635    EFN70236.1    ABLF02005485    RSAL01000093    RVE47898.1    ABLF02003109    ABLF02024163    ABLF02065890    ABLF02066605    AJVK01034414    GEZM01007799    JAV94911.1    ABLF02018098    MRZV01000842    PIK43542.1    GEZM01095994    JAV55218.1    GEZM01007800    JAV94909.1    GEZM01073324    JAV65152.1    GGMR01005938    MBY18557.1    GALX01003736    JAB64730.1    GEZM01073325    JAV65151.1    ABLF02010172    KQ980298    KQ978748    KYN13019.1    KYN16830.1    KYN28629.1    KQ976993    KYN06573.1    ABLF02017766    GEZM01031193    GEZM01031192    JAV84976.1    RJVU01019282    ROL50904.1    GEZM01031183    JAV84989.1    ABLF02005824    ABLF02005825    ABLF02005826    ABLF02005827    ABLF02050516    ABLF02053731    AJVK01060859    GGMR01013915    MBY26534.1    KQ977417    KYN02849.1    GGMR01019037    MBY31656.1    ABLF02041912    AJVK01061645    KYN17779.1    ABLF02031636    ABLF02031641    ABLF02031645    ABLF02031655    ABLF02046386    ABLF02048949    ABLF02010159    KQ982514    KYQ55617.1    ABLF02008986    ABLF02008987    KQ979155    KYN22412.1    ABLF02005565    ABLF02021063    LBMM01003425    KMQ93551.1    AJVK01026634   
Pfam
PF12017   Tnp_P_element        + More
PF05485   THAP
PF14291   DUF4371
PF00076   RRM_1
Interpro
IPR006612   THAP_Znf        + More
IPR021896   Transposase_37       
IPR038441   THAP_Znf_sf       
IPR012337   RNaseH-like_sf       
IPR025398   DUF4371       
IPR001315   CARD       
IPR034772   CPSF6/7       
IPR000504   RRM_dom       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR034771   CG7185-like       
IPR035979   RBD_domain_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF54928   SSF54928       
Gene 3D

Ontologies

Topology

Length:
535
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.61461
Exp number, first 60 AAs:
0
Total prob of N-in:
0.07833
outside
1  -  535
 
 

Population Genetic Test Statistics

Pi
112.318873
Theta
146.84106
Tajima's D
-0.906712
CLR
75.437796
CSRT
0.152842357882106
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号