SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13663  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA011033
Annotation
hypothetical_protein_KGM_21815_[Danaus_plexippus]
Location in the cell
Cytoplasmic   Reliability : 1.095 Extracellular   Reliability : 1.246
 

Sequence

CDS
ATGCAGTTATGGCGCCAGGACAGTACAAACACAGGGGTGCTACTCCTACTCTCGTCTATACATTTCCAGTGTCGGAGACTGGACAAGTCTGCTCATTTTTCCACATTGGCGATCAAACAGAATCCTTTGTTGGCTGAAGCCTACAGCAACTTGGGCAATGTTTACAAAGAACGCGGGCAGCTTCAGGAGGCGCTGGAGAACTATCGTCACGCTGTCCGTTTGAAGCCGGACTTCATCGATGGATACATCAACTTGGCTGCGGCTCTCGTTGCCGCCGGCGATATGGAGCAAGCTGTGCAGGCTTACGTTACCGCACTGCAGTATAACCCTGATTTGTACTGCGTCAGAAGCGATTTGGGCAATTTGCTCAAAGCCCTCGGAAGACTAGACGAGGCAAAGGCTTGTTACTTGAAGGCAATCGAAACTAGACCCGATTTCGCGGTCGCCTGGAGCAACTTGGGTTGCGTTTTCAATGCGCAGAGTGAAATATGGTTGGCAATTCATCATTTCGAAAAAGCTGTCGCATTGGATCCCAATTTCTTAGACGCGTACATTAATTTAGGAAATGTACTAAAAGAAGCTAGAATTTTTGACAGGGCCGTCGCCGCATATTTGAGAGCCTTGAATTTATCTCCCAATAATGCCGTCGTGCACGGCAATTTGGCCTGCGTGTACTACGAACAAGGACTGATTGACTTGGCCATCGATACTTATCGACGTGCCATCGAATTACAACAGAACTTCCCGGACGCGTATTGCAATTTAGCTAATGCACTCAAAGAAAAGGGACAAGTGACTGATGCTGAAGAGTGTTATAATACCGCGTTACGTCTCTGTCCGTCTCATGCAGACTCCCTCAACAATCTGGCTAATATAAAACGGGAACAAGGCTACATCGAGGAGGCTACACGTTTATATTTAAAAGCATTAGAAGTGTTCCCGGAGTTTGCGGCGGCGCATAGTAATCTGGCTTCAGTGTTGCAACAACAAGGGAAACTAAACGAAGCCCTTATGCATTACAAGGAAGCTATACGTATTCAGCCGACCTTTGCCGATGCGTATAGCAACATGGGCAATACGCTGAAGGAAATGCAAGATGTAGCCGGTGCTCTGCAATGCTACACAAGGGCGATTCAAATTAATCCCGCATTTGCGGATGCTCATAGCAATTTGGCCAGCATCCACAAAGATTCTGGTAACATTCCTGAAGCTATACAGTCGTACAGAACAGCGCTTAAGCTTAAACCAGACTTCCCAGATGCGTATTGCAATTTAGCCCACTGTTTACAAATAGTGTGTGACTGGACGGATTATGAGGCTCGAATGAAAAAATTGGTCAGCATTGTCGCTGAGCAGCTGGAGAAAAACAGACTGCCATCAGTACATCCGCACCACTCCATGTTGTATCCGCTGACACATGACTTTAGGAAGGCCATCGCCGCCCGTCACGCGAACCTTTGCTTGGAGAAAGTGCAAGTGTTGCACAAAAACCCTTACAAGTTCCCTAGAGATTTACAAGGCCGCCTTCGTATCGGGTACGTAAGCAGCGATTTCGGTAACCATCCGACATCGCATTTGATGCAATCGGTACCTGGTTTGCATGACCGAACAAAAGTGGAAATATTCTGCTATGCCCTCAGTCCGGACGACGGAACAACGTTCCGATCGAAAATCGCCAGGGAAGCGGAGCATTTTATCGATCTATCTCAGATGCCTTGTAACGGCAAAGCAGCCGATAAAATATACGGAGACGGTATTCATATCTTGGTCAATATGAATGGATACACTAAAGGAGCGCGAAATGAAATTTTCGCTTTGAGACCAGCCCCGGTCCAGGTAATGTGGCTCGGGTACCCGGGAACTAGCGGGGCTAGTTACATGGACTATTTAGTTACTGATGCAGTGACGTCACCCGTGGAACTTGCCAGCCAATATAGCGAAAAACTAGCGTACATGCCACACACGTATTTTGTTGGCGATCACAAGCAAATGTTCCCACATTTACAAGAACGTCTGATTCTGAGCGACAAAGTTAAATCCCACAACAATTTGGGAAGTGTCGCGGACAATGTTGCTGTGATTAACGCGACCGATCTGTCGCCCCTTGTGGAAAATACTGACATTAAAGAAATAAAAGAGATCGTGCGAGCAGCCAGACCCGTTGAAATATCTTTGAAAGTAGCCGAATTGCCAACGACGACACCCATTGAAACTATGATTGCATCAGGACAAGTACAGACATCCGTAAATGGCGTTATTCTTCAAAATGGCTTAGCTACTACGCAGACGAACAACAAGGCTGCGACGGGCGAGGAAGTACCACAATCTATAGTGATTACAACTCGACAACAATACGGCTTACCGGATGACGCCGTAGTGTACTGCAACTTCAACCAATTGTATAAGATTGACCCATTAACTCTACACATGTGGGTGTACATACTGAAACATGTACCTAACAGTGTATTATGGTTATTAAGATTCCCGGCCGTAGGAGAACCCAATTTACAATCCACTGCCAACCAACTTGGTCTTCCGCCGGGACGGATAATATTCTCAAATGTTGCTGCCAAAGAAGAGCACGTACGACGCGGACAGTTAGCCGATGTGTGTCTCGACACTCCACTTTGTAATGGACACACAACTAGTATGGACATCCTATGGACTGGCACACCGGTTGTGACCCTTCCTGGGGAGACTTTGGCGTCTCGAGTGGCAGCTTCTCAATTAAATACTTTAGGATGTCCCGAGCTCATTGCCAGAACGAGACAAGAATACCAAGACATAGCTGTAAGACTGGGAACAGATAGAGAATACCTAAAAGCGATCAGAGCAAAGGTGTGGACAGCTCGCACTGACAGTCCTCTTTTCGACTGCAAGGCGTACGCCACCGGACTTGAGATGCTGTACAACAGGATGTGGTCGAGGCACGCGCGAGGCGATCGCCCTGATCATATACAGGCCCTCGAGAAATAA
Protein
MQLWRQDSTNTGVLLLLSSIHFQCRRLDKSAHFSTLAIKQNPLLAEAYSNLGNVYKERGQLQEALENYRHAVRLKPDFIDGYINLAAALVAAGDMEQAVQAYVTALQYNPDLYCVRSDLGNLLKALGRLDEAKACYLKAIETRPDFAVAWSNLGCVFNAQSEIWLAIHHFEKAVALDPNFLDAYINLGNVLKEARIFDRAVAAYLRALNLSPNNAVVHGNLACVYYEQGLIDLAIDTYRRAIELQQNFPDAYCNLANALKEKGQVTDAEECYNTALRLCPSHADSLNNLANIKREQGYIEEATRLYLKALEVFPEFAAAHSNLASVLQQQGKLNEALMHYKEAIRIQPTFADAYSNMGNTLKEMQDVAGALQCYTRAIQINPAFADAHSNLASIHKDSGNIPEAIQSYRTALKLKPDFPDAYCNLAHCLQIVCDWTDYEARMKKLVSIVAEQLEKNRLPSVHPHHSMLYPLTHDFRKAIAARHANLCLEKVQVLHKNPYKFPRDLQGRLRIGYVSSDFGNHPTSHLMQSVPGLHDRTKVEIFCYALSPDDGTTFRSKIAREAEHFIDLSQMPCNGKAADKIYGDGIHILVNMNGYTKGARNEIFALRPAPVQVMWLGYPGTSGASYMDYLVTDAVTSPVELASQYSEKLAYMPHTYFVGDHKQMFPHLQERLILSDKVKSHNNLGSVADNVAVINATDLSPLVENTDIKEIKEIVRAARPVEISLKVAELPTTTPIETMIASGQVQTSVNGVILQNGLATTQTNNKAATGEEVPQSIVITTRQQYGLPDDAVVYCNFNQLYKIDPLTLHMWVYILKHVPNSVLWLLRFPAVGEPNLQSTANQLGLPPGRIIFSNVAAKEEHVRRGQLADVCLDTPLCNGHTTSMDILWTGTPVVTLPGETLASRVAASQLNTLGCPELIARTRQEYQDIAVRLGTDREYLKAIRAKVWTARTDSPLFDCKAYATGLEMLYNRMWSRHARGDRPDHIQALEK

Summary

Catalytic Activity
S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.
EMBL
BABH01019450    AGBW02012603    OWR44731.1    ODYU01002802    SOQ40748.1    KQ459597    + More
KPI94754.1    KQ460473    KPJ14407.1    NWSH01000423    PCG76494.1    GFDF01001462    JAV12622.1    KQ971331    EFA01003.1    GFDF01001473    JAV12611.1    KZ288255    PBC30698.1    GEZM01013689    GEZM01013687    JAV92369.1    JR036953    AEY57499.1    JR036952    AEY57498.1    GEZM01013688    JAV92370.1    LJIG01016195    KRT81330.1    KQ981948    KYN32648.1    KQ976723    KYM76681.1    KQ435724    KOX78410.1    ADTU01025121    GL887898    EGI69572.1    QOIP01000011    RLU16638.1    KK107078    EZA60211.1    KQ760514    OAD60022.1    GL441834    EFN64211.1    AAAB01008960    EAA10760.4    GGFK01002408    MBW35729.1    GGFL01004463    MBW68641.1    GGFK01002651    MBW35972.1    GECU01006701    JAT01006.1    AXCN02000346    GDKW01000423    JAI56172.1    GBBI01002194    JAC16518.1    GBGD01000245    JAC88644.1    GGFJ01001095    MBW50236.1    GGFJ01001238    MBW50379.1    GGFJ01001195    MBW50336.1    GGFL01005015    MBW69193.1    GGFM01000894    MBW21645.1    GECL01003455    JAP02669.1    GFDL01003711    JAV31334.1    GBHO01003282    GDHC01006945    JAG40322.1    JAQ11684.1    GBHO01027602    JAG16002.1    GANO01001840    JAB58031.1    GFTR01008528    JAW07898.1    DS235873    EEB19625.1    KB630245    KB630279    KB631948    ERL83496.1    ERL83514.1    ERL87411.1    CH963849    EDW74466.1    CP012524    ALC42656.1    APGK01058526    KB741291    ENN70496.1    OUUW01000032    SPP89814.1    UFQT01001415    SSX30450.1    CH933808    EDW09783.1    CCAG010016602    JXJN01014862    GAMC01012750    JAB93805.1    KA645251    AFP59880.1    CM002911    KMY91610.1    KMY91611.1    AF217788    AE013599    BT032865    AAF32311.1    AAF57338.1    AAG22338.1    AAG22339.1    ACD81879.1    CH891608    KRK05133.1    CH954177    KQS71055.1    CH940648    EDW61182.1    KRF79836.1    KRF79837.1    CH916367    EDW01934.1    GAKP01001254    JAC57698.1    GBXI01014423    JAC99868.1    GDHF01023546    GDHF01003699    JAI28768.1    JAI48615.1    JTDY01002347    KOB71619.1    ABLF02036676    KK121753    KFM81144.1    GFAH01000023    JAV48366.1    GL732582    EFX74619.1    GDIQ01253079    GDIQ01221586    GDIQ01142217    GDIP01123524    GDIQ01010608    LRGB01003134    JAJ98645.1    JAL80190.1    KZS04078.1    GDIQ01146514    JAL05212.1    GDIP01033088    JAM70627.1    GDIQ01084085    JAN10652.1    QCYY01003673    ROT62470.1    AF145622    AAD38597.1    GFJQ02004367    JAW02603.1    GDRN01100857    JAI58476.1    GFWV01009277    MAA34006.1    GGLE01007113    MBY11239.1    GBBK01002057    JAC22425.1    GEDV01003056    JAP85501.1    GBBL01002597    JAC24723.1    JH432064    GFPF01011031    MAA22177.1    GANP01003940    JAB80528.1    JRES01000466    KNC31004.1   
Pfam
PF13844   Glyco_transf_41        + More
PF00515   TPR_1
PF13181   TPR_8
PF00632   HECT
PF00400   WD40
PF00397   WW
PF00168   C2
PF00832   Ribosomal_L39
PF07719   TPR_2
Interpro
IPR013026   TPR-contain_dom        + More
IPR037919   OGT       
IPR011990   TPR-like_helical_dom_sf       
IPR019734   TPR_repeat       
IPR029489   OGT/SEC/SPY_C       
IPR001440   TPR_1       
IPR003107   HAT       
IPR000569   HECT_dom       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR035983   Hect_E3_ubiquitin_ligase       
IPR001680   WD40_repeat       
IPR035892   C2_domain_sf       
IPR017986   WD40_repeat_dom       
IPR020472   G-protein_beta_WD-40_rep       
IPR036020   WW_dom_sf       
IPR036322   WD40_repeat_dom_sf       
IPR019775   WD40_repeat_CS       
IPR001202   WW_dom       
IPR000008   C2_dom       
IPR000077   Ribosomal_L39       
IPR020083   Ribosomal_L39_CS       
IPR023626   Ribosomal_L39e_dom_sf       
IPR013105   TPR_2       
SUPFAM
SSF48452   SSF48452        + More
SSF51045   SSF51045       
SSF56204   SSF56204       
SSF50978   SSF50978       
SSF48662   SSF48662       
PDB
5A01     E-value=0,     Score=3282

Ontologies

Topology

Length:
991
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12309
Exp number, first 60 AAs:
0.00542
Total prob of N-in:
0.00555
outside
1  -  991
 
 

Population Genetic Test Statistics

Pi
300.014716
Theta
205.997332
Tajima's D
1.478554
CLR
0.372515
CSRT
0.782310884455777
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号