SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13661
Pre Gene Modal
BGIBMGA011034
Annotation
toll_receptor_18_wheeler_[Spodoptera_frugiperda]
Full name
Toll-like receptor 7      
Location in the cell
Nuclear   Reliability : 2.18 PlasmaMembrane   Reliability : 1.535
 

Sequence

CDS
ATGGACACAGTTGTTATTAAAATGATAATAAACACAATATTCTTTTGTTTTGTGATGGGCGCGGCGCTTACGGAAGCACCGGACGATGCAGATGCGTGTTTTCGTGTGGCAAGTGTGGACGGTATGGTGGAGTGCAATGTACGGACGTTGTCGTCGGACAGAGATGTCGTCGGTTCGATGCACTCGGATGGCACGGAGCGGCTCACAATCCGCTGTAGCCAGCTCCTGATCGAGAGCACCCTCAGGGATCATCATTTTGGAAAGATGCAAGGTCTAGCGGAGATATCGATTCACAATTGCAAGATATTGCGACTTCCGGGCAACGTCTTCGAGGGCTTGCGAGGTCTGAAGTCGTTGAAGATACGTTCGATGAACAACGAATGGGGCATAAATAAAGAGCTGGACTTTACGTTGGGCGCTTTCAACGGGTTGCGAGAGCTCCACACTTTGGACCTCGCTTATAATAACATCAGAAAAATACCATCTGATCTCTTCTGTGCTTTGGAAAATATAATATCTCTTAATTTAACTCACAACAAAATTAAATTTGTGGACGAACTGGGTTTCGGGCACAAATGTGGCTCTACGCTACAAAGGATAGATTTGAGTTTCAACGACATTATGTCCTTGCCGGCTGACTCCGAAATTTTACATTTAAGGAGGCTGACGCAGCTGTTTTTACAGAACAATAAAATAAGCGAGTTGCCGACTGAAGTTTTTAGTGATCTACTCTCGCTGAAAGTGGTGAACATTTCCGATAACGCTATTAACTATTTACCCGAAGGATTGTTTCATAATACAAGAGAGATTCGAGAAATTTACATGCAAAATAATGAGCTGGAAATTCTGCCGAAGAGAATATTTAATCGGTTGGAACAATTGCTCGTTTTAGATCTTTCGGCGAATAAATTGAAGAGCGACCACATAGAAGATGAAACGTTTAGCGGTCTAATAAGATTAATCGTGCTCGACCTATCGCATAACGTACTCACGCGGATTACTCGCAACATATTTAAGGACCTCTTTTGTTTACAAATACTCAGTTTAAATAATAATTCCATTGGATATGTTGAAGATAACGCCTTTTCGCCGCTTTATAACTTGCATACACTAAATTTGGGCCAGAATATGTTACACGCTGTAGAGGACCACATGTTTAATGGTTTATTTATTTTGAATAAACTAAACGTAAACAATAACTTACTGTCTTTTGTAAGTGTAAATGCATTTAAGAATTGTTCGGATTTGAAAGAATTAGACCTCAGTTCGAATAAGTTAACAAAAATACCGGAAGCAATATTGCAGTTACCTTTCTTGAAATCGTTGGACCTCGGAGAAAATTTATTAACGGAAATAACCAATAATTCATTTCAAAATCTATCGCAGTTGACCGGGTTACGTTTAATCGACAATCAAATTGGAAACCTTACCGCGGGCATGTTCTGGGCCTTGCCTGGCTTGCAAGTGCTTAATTTGGCGAAAAATAAAATTCAATCTATCGAAACTGAAACCTTTCAAAAGAACACACAATTGGAAGCCGTTCGTCTGGATGGTAACTTCGTTTCTGATATTAATGGTGTGTTCGTGGCTTTGACCAAATTGTTATGGTTGAATTTATCGGAGAATCATTTGGTTTGGTTCGATTACGCTTTTATACCAGGTAACTTGAAATGGTTGGATATTCATGCAAATTTCATTGAAATTCTCGGCAATTATTATAAAATTCAAAAAGAGTTACACATTAAAACTTTAGATGTTAGTCACAATCGTTTAGCAACTATATCGCCAATGTCAATACCAAATAGTGTTGAACTTTTATTTATAAACAACAATTTAATATCGAGCGTAGAGACGGACACCTTTCTAGAGAAGAGAAACTTGACTCGCGTCGATATGTATGCCAATGAGATTGAAAGTTTGGATATAAATAGTTTACGCATTTCGAGAGTGTCCGAAGATCGAACATTACCCGAGTTTTATATCAGCGGGAATCCATTTCGTTGCGATTGCAACATGAAATGGCTTTTGCTCATTAACTCCATCACATCGAGGCAATACCCGAGAGTGATGGATTTAGAAAATGTTATTTGTAAAGAGTCTTATGTACGCGGTGTTAAATATCTCTCAGTAACTTCGTTGCATCTTAAAGACTTCTTGTGTAAGTACGAAACCTATTGTCCGGATAATTGTGAATGCTGCGATTTAAATGACTGCGACTGTAAAACTTACTGTCCTACAAACTGTTCATGTTATCACGATTCTAGTAAAAGCACGAGCGTTGTTGATTGTTCTGTGCAACAATTAAAAGTAGTGCCTACAGCCTTTCCCATCGACGCGACACACATTTATTTAGACGGAAATGTTTACAGTGAACTCGGCGAAACCTTTTTCGATTCAATGCGCAACGCTTACGTCATTTATCTTAACGCTAGTAACATTATTATAATCAGGAATAATACGTTTAGTCAACTCCGAGACCTGAGGATATTACATTTAGACAACAATAAACTTAAACAATTACGGGGCCTCGAATTCTCAAAGTTAAGCAGCTTGAAAGAACTCTACCTCCAAAGTAATTTAATTGAGTATATTTCGAACGAAACTTTTTCTCAGTTGGGAGCGCTAGAAGTTTTGCGTTTGGACGGGAACCGGCTCGTGAATTACGGACTGTGGCATTTGGACAATAACAAAAAGTTACAAACATTGTTTATTGGAAACAACAATTGGTCATGCGATTGTAAATATTTACAAGGGTTCTTGACGTATGTGTCTCAGAATATTGAAAAAGTACTCGATATTCATAGTTTGTGGTGTGTGAATGAAAAACTAAAACCAGTTAAGAAGCCTTTGAATTTAAATATTACAGTTTGTAGTGAAATAAGTGAAAACTCAATGATGAGCGCCTTCTTTGTTTCCCACAACCTTCCGTTATTGGCGTCTGCCATCACCGGCTTCATGCTCATTTTATTAATATTGGCTTTGATATTCACATTTAGATATGCTTGTAGAATGTGGCTGTATTCGAACTGTGGAATTAAATTGTCCCCTTTGGCCTTTAAGGATACCGATAAACTTTACGACGCGTACGTCTGCTATAGCCCTAAAGACGAGGAGTTTGTAATAGAAACGTTGGCCCGAGAATTAGAAAACGGGTATCCGTCGTATCATCTCTGCCTTCATTACAGAGATGTACCACATTTTGAGGCGACATACGCACAGTTTCCAGACTTGGTAGTCGAAGCTACGGAAGCTTCAAGGCGTATCATAGTGGTGTTAACAAATAATTTCATTACAACGGAGTGGTCTCAGATAGAATTCCGACAAGCCCTGCAGAAAGCACTCCGAAAGAATCCAAACAAATTAATAATCGTCGCCGTAGGGCCCGTCCCACGAGATCCGGAGTTGAAGTCATATTTCAAAACGGGTTTGGAGATAACATGGAAGGAGAAACGGTTTTGGGAAAGGTTACGTTATGCGATGCCGTCTTCAAAGCGGCACGGGCATAAGTTAAAAATACTTAATTACGGAAGAAATTCTAATACGTACACAATGGACGCGTCGGTGTTAAACAGTACGTGCCAGACGCTCTGCGGAAAGTCTGCAAATTCTGCAGAGCGTTCGCCCTGTGATCGCCCCCTATCCGAACACATATATTCTACAATAGATTCGGATTACTCGTCAACAGATTTCCAAGGCCGACACAATCAGCCGCAGTCTGTGGTTTTCCAACATACTGTTCAAACGTACCTGGTATAA
Protein
MDTVVIKMIINTIFFCFVMGAALTEAPDDADACFRVASVDGMVECNVRTLSSDRDVVGSMHSDGTERLTIRCSQLLIESTLRDHHFGKMQGLAEISIHNCKILRLPGNVFEGLRGLKSLKIRSMNNEWGINKELDFTLGAFNGLRELHTLDLAYNNIRKIPSDLFCALENIISLNLTHNKIKFVDELGFGHKCGSTLQRIDLSFNDIMSLPADSEILHLRRLTQLFLQNNKISELPTEVFSDLLSLKVVNISDNAINYLPEGLFHNTREIREIYMQNNELEILPKRIFNRLEQLLVLDLSANKLKSDHIEDETFSGLIRLIVLDLSHNVLTRITRNIFKDLFCLQILSLNNNSIGYVEDNAFSPLYNLHTLNLGQNMLHAVEDHMFNGLFILNKLNVNNNLLSFVSVNAFKNCSDLKELDLSSNKLTKIPEAILQLPFLKSLDLGENLLTEITNNSFQNLSQLTGLRLIDNQIGNLTAGMFWALPGLQVLNLAKNKIQSIETETFQKNTQLEAVRLDGNFVSDINGVFVALTKLLWLNLSENHLVWFDYAFIPGNLKWLDIHANFIEILGNYYKIQKELHIKTLDVSHNRLATISPMSIPNSVELLFINNNLISSVETDTFLEKRNLTRVDMYANEIESLDINSLRISRVSEDRTLPEFYISGNPFRCDCNMKWLLLINSITSRQYPRVMDLENVICKESYVRGVKYLSVTSLHLKDFLCKYETYCPDNCECCDLNDCDCKTYCPTNCSCYHDSSKSTSVVDCSVQQLKVVPTAFPIDATHIYLDGNVYSELGETFFDSMRNAYVIYLNASNIIIIRNNTFSQLRDLRILHLDNNKLKQLRGLEFSKLSSLKELYLQSNLIEYISNETFSQLGALEVLRLDGNRLVNYGLWHLDNNKKLQTLFIGNNNWSCDCKYLQGFLTYVSQNIEKVLDIHSLWCVNEKLKPVKKPLNLNITVCSEISENSMMSAFFVSHNLPLLASAITGFMLILLILALIFTFRYACRMWLYSNCGIKLSPLAFKDTDKLYDAYVCYSPKDEEFVIETLARELENGYPSYHLCLHYRDVPHFEATYAQFPDLVVEATEASRRIIVVLTNNFITTEWSQIEFRQALQKALRKNPNKLIIVAVGPVPRDPELKSYFKTGLEITWKEKRFWERLRYAMPSSKRHGHKLKILNYGRNSNTYTMDASVLNSTCQTLCGKSANSAERSPCDRPLSEHIYSTIDSDYSSTDFQGRHNQPQSVVFQHTVQTYLV

Summary

Description
Toll-related receptor which binds to the neurotrophins NT1 and spz5 (PubMed:10973475, PubMed:23892553). Essential for antiviral autophagy, it detects and binds to the vesicular stomatitis virus (vsv) following infection (PubMed:22464169). This role is likely to be independent of the canonical Toll, immune deficiency, and JAK-STAT signaling pathways (PubMed:22464169). Functions in olfactory circuit assembly by promoting synaptic partner matching between olfactory receptor neurons (ORN) axons and projection neurons (PN) dendrites partners in the antennal lobe (PubMed:25741726). Function in the Va1d ORNs is necessary and sufficient for correct targeting to their partner PN dendrites (PubMed:25741726). Also involved in the targeting of other classes of ORN axons (PubMed:25741726). Functions with Toll-6 to regulate motor axon targeting and neuronal survival in the central nervous system (CNS) (PubMed:23892553). May be an upstream component of the NF-kappa-B (rel) regulatory cascade (PubMed:23892553).
Similarity
Belongs to the Toll-like receptor family.
Keywords
Cell membrane   Complete proteome   Developmental protein   Disulfide bond   Immunity   Innate immunity   Leucine-rich repeat   Membrane   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Toll-like receptor 7
EMBL
NWSH01000423    PCG76493.1    HQ852232    ADV41489.1    ODYU01013217    SOQ59911.1    + More
JTDY01006633    KOB65817.1    MH243027    AXS59161.1    KQ460473    KPJ14406.1    KQ459597    KPI94753.1    BABH01019412    AB070579    BAB85498.1    KZ149988    PZC75639.1    JTDY01003195    KOB69977.1    ODYU01008633    SOQ52385.1    KPJ14395.1    ODYU01005119    SOQ45671.1    MH243026    AXS59160.1    NWSH01001862    PCG69881.1    KPJ14394.1    BABH01019375    KQ459595    KPI95821.1    JTDY01001788    KOB72878.1    AGBW02010899    OWR47539.1    GDHC01002096    JAQ16533.1    ACPB03002369    KC355236    AGK40936.1    GEZM01011983    JAV93317.1    GEDC01004297    JAS33001.1    KQ971311    EEZ99327.1    PYGN01018333    PSN28975.1    NEVH01011197    PNF31811.1    DS235819    EEB17714.1    KX086263    KK854062    ANG08886.1    PTY10520.1    KK852574    KDR21050.1    APGK01021779    APGK01021780    KB740363    ENN80811.1    KB631964    ERL87512.1    GBYB01008155    JAG77922.1    KQ764513    OAD54497.1    KQ434835    KZC07924.1    KQ414628    KOC67361.1    KQ981856    KYN34631.1    GL446009    EFN88591.1    KQ982629    KYQ53430.1    KK107139    QOIP01000003    EZA57742.1    RLU24395.1    GL438820    EFN68383.1    KQ976440    KYM86510.1    LBMM01002090    KMQ95281.1    ADTU01005045    AY937243    AAX33677.1    GL765434    EFZ16266.1    KQ977580    KYN01749.1    ABLF02028882    GDHF01031799    GDHF01030188    JAI20515.1    JAI22126.1    GAMC01019149    JAB87406.1    GGMR01003079    MBY15698.1    GBXI01004062    JAD10230.1    GFXV01002236    MBW14041.1    ATLV01023858    KE525347    KFB49716.1    JRES01001589    KNC21654.1    KNC21696.1    CM000071    EAL26021.2    CH479181    EDW32586.1    CP012524    ALC42769.1    OUUW01000001    SPP75502.1    DS232609    EDS44003.1    CH480816    EDW48643.1    DQ138916    ABA86522.1    CM000362    CM002911    EDX07855.1    KMY95189.1    AF247765    DQ138914    AE013599    BT125656    AAF86225.1    ABA86520.1    ADN32842.1    DQ138915    ABA86521.1    CH477246    EAT46215.1    JXUM01065388    KQ562345    KXJ76106.1    DQ138917    ABA86523.1    CCAG010000917    JXJN01003516    DQ138919    ABA86525.1    DQ138918    ABA86524.1    CH954179    KQS62206.1    EDV55258.1    CM000158    EDW91449.1    CH963850    EDW74839.1    CH933808    EDW10441.1    CH940648    EDW60302.1    AXCM01003257   
Pfam
PF13855   LRR_8        + More
PF13306   LRR_5
PF01582   TIR
PF00560   LRR_1
PF13516   LRR_6
PF01462   LRRNT
PF13676   TIR_2
Interpro
IPR035897   Toll_tir_struct_dom_sf        + More
IPR032675   LRR_dom_sf       
IPR000157   TIR_dom       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR000372   LRRNT       
IPR026906   LRR_5       
IPR000483   Cys-rich_flank_reg_C       
SUPFAM
SSF52200   SSF52200       
Gene 3D
PDB
4KT1     E-value=3.18231e-25,     Score=290

Ontologies

Topology

Subcellular location
Cell membrane  
SignalP
Position:   1 - 24,         Likelihood:  0.856658
 
 
Length:
1251
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
31.3027399999999
Exp number, first 60 AAs:
8.18221
Total prob of N-in:
0.40517
outside
1  -  974
TMhelix
975  -  997
inside
998  -  1251
 
 

Population Genetic Test Statistics

Pi
305.708881
Theta
219.119112
Tajima's D
1.259663
CLR
0
CSRT
0.731513424328784
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号