SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13658
Pre Gene Modal
BGIBMGA011035
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.095
 

Sequence

CDS
ATGGCATTAATTGAAAAGCTATCAGGCCGTGATAACTTTGCAACTTGGCGATTTGCAATGCAAACATACTTGCAACACGAGGAGCTGTGGGATTGTATAGAAGATGAGGTAAAAGATACAAAACGAGATATTAAAGCAAAAACAAAGATTATTCTCTCAGTGGATCCGATAAACTATGTTCACATACAAGAGGCGAAGACTGCGAAGGAAGTTTGGCACAAATTAACATCAGCATTCGATGACTCCGGGCTAACACGCCGAGTTGGTCTACTGCGTGACCTTTGTAATACATCACTTGCTGGATGCCAAAATGTAGAGGAATACGTAAGCAAAATTATTAACACTGCCTACAAGCTAAGAAACATAGGCTTTAAAGTAGATGACGAGTGGCTAGGTACACTGCTGCTCTCCGGTCTACCCGAATCTTACCAACCTATGATAATAGCTATTGAGAGTTCCGGCATGAAAATCAGTTCAGACTCAGTAAAGGCAAAACTACTACAAGATGTAAGACCACCTGAAAATGACTCAAAAGCATTTGCAGTTACCAAGAAATTTCATAAGAATTCCAAAAAGCAATCAAAAGGACCAAGGTGCTACACTTGTAATAAATATGGACATAAAAGTCCAGAATGTAAAAACAAGACTAAAGATACACAAAAAGCAAGTAACTCATATGCTGCTGTTTTTGTAGCATCTACGACTCAAGATGATGCCTGGTACGTGGACTCAGGTGCATCCTCACACATGACCAAACATAGAGGTTTGCTGTCAAATGAGAATGACACGCCTTCTGTAAAGACAATTAGAACTGCAGATAACAAAATTTTAAATGTGCAATGCTCAGGGCAAGTGAGCTTAAATGTATGTAATAAGAAGGGTCAAGAAAATAAATTATTATTCAGAAATGTGTTATGTGTTCCCGAACTAGCAACTAATTTGATATCAGTTAGCCAGATTGTCAGAAGCGGTGGCCAAGTAAGGTTTAATCAAAATGGCTGTGCTATTATAAACAGAGGTCAGATAGTAGCAACGGCCAGTATCATCAACAACATGTACCGGCTAAATATGCCTGGAAGAGGCTATGCATGCATGTCTGATGTTGACGCAGAGGATATTTACCTATGGCACCAAAGAATGGGACACCTGAATTTTAATAGTCTGAAAAAGATGTCTGACAATGTAGATCATGTAATTTTCTCTGAAAAATCAGAAAATCTGTCATGTATCACCTGCAAAGAAGGTAAGCAAACGAGGCTGCCTTTTAAAAGTGAATGCAAGAGAGCACAAACCCCTCTTCAATTGGTTCACTCAGACATATGTGGTCCTATGGAAACACAAACACTCGGTGGATCTAAATACTTCATAACATTCCTGGATGATTATTCAAAGAAGATCTATGTATATTTTCTCCGGAATAAGTCAGATGCTCTAGAAAAGTTTAAAGAATTCAGAAATGAAGTCGAAAATCAACTTGAAGCTCGTATAAAAGTTCTCCGGACAGACAATGGATTGGAATATGTCAATAACAATTTTTCTGATTACTTGAAGAGTTGTGGAATTATACATCAAACAACCACACCATACACTCCAGAGCAAAATGGGACTGCGGAACGAATGAACAGAAGTCTTATAGAAAGAGCAAAGTGTATGCTCCTGAATGCCAATTTACCTAAACTATATTGGGCTGATGCAGTGCACACTGCTGCTTATATCATAAACCGTTCACCAACAAAGTCTTTGTCATTTAAAACACCAGAAGAGTTATGGTCTGGACAGAAGCCATATGTGAAACATATGCGTATATTTGGCTGTGAAGCTATGGTACACTTACCACAGGAGAAACGCAGAAAGTGGGACCCAAAAGCACAGAAGATGATCTTTATTGGATATTGTGATCACACCAAAGGCTATCGATTCATAATACCAAATTCCAGAAAAGTGATAAAAAGCAGAGACGCTACATTCCTTGAATCAACTGTCAAAAGGGACTATGTTCCCATAGAACTATCTCAAAAGAAACCATCAATGAATATTGATGACAGCAAAGAAAGTGAAACATCTGAAATGACAGATGATTCTACTTCAACAGGTTCATATGATACTGTATGTGACACTAAATCATCAGACAGCGACTACCTACCTGATAGGAGTTATGATAGTCTCCCTATCTCTAACATAACTCTACGCCGAAAGAAGAAGGTGCAACAGTCTTCTGATGATCCAGAAGAGAATACATACTTGTGTCAGGATGAAGTTATGCTTTTGGACGTTCCTGAAACATATAAAGAAGCTGTGAACTCAATCCATAAAGAGAAATGGATGAGATCTATAGACGAGGAATTACATGCTCATCAGAAAAATAATACATGGACATTGGTTCAGAGACCTGCTAATACCAAAGTTATAAATTGTAAATGGGTATTCCGTATAAAGGATGAACCAACCGGACCAAGGTATAAATCAAGGCTGTGTGCCAAAGGATATGCACAAACCAAAGGCATAGACTACAATGAAACATTTGCACCAACTGTGAGGTACGATTCTATACGTATATTATTATCTGTAGCTGCTCAGAATAATCTTAAAGTTATTCAACTTGATGTGAAGACAGCATTCCTGTATGGAGAGCTGGAGGAGGTCATATTCATGTCACCACCAGAAGGCCTACCTTGTGAAGAAAACATGGTATGTAAACTTAATAAATCCCTCTATGGTTTGAAACAGGCTCCGAGGTGCTGGAACAGCAAATTTGATACTGTTCTGAAGAAGTATGGCTTTGTCAACACTAAGGCAGATCAATGTGTTATTCCAGTTGACCCTCATGTAAAGTTGCAAAAGGGTAATGAAGAACCTAATAAAAGTATACCATACAGACAAGCGGTCGGCTCCCTGATGCATGTGGCTATAGTGAGTCGTCCCGATGTCATGTTTGCTGTCAGTCTGAACCGTCAGAAACTACAGGCTACAGCGATGCAGACTATGCAAATGATCTGGATAACCGTAGATCAGTTACTGGCTATGTTTTTATCAAGAATGGAGCAGCTATAA
Protein
MALIEKLSGRDNFATWRFAMQTYLQHEELWDCIEDEVKDTKRDIKAKTKIILSVDPINYVHIQEAKTAKEVWHKLTSAFDDSGLTRRVGLLRDLCNTSLAGCQNVEEYVSKIINTAYKLRNIGFKVDDEWLGTLLLSGLPESYQPMIIAIESSGMKISSDSVKAKLLQDVRPPENDSKAFAVTKKFHKNSKKQSKGPRCYTCNKYGHKSPECKNKTKDTQKASNSYAAVFVASTTQDDAWYVDSGASSHMTKHRGLLSNENDTPSVKTIRTADNKILNVQCSGQVSLNVCNKKGQENKLLFRNVLCVPELATNLISVSQIVRSGGQVRFNQNGCAIINRGQIVATASIINNMYRLNMPGRGYACMSDVDAEDIYLWHQRMGHLNFNSLKKMSDNVDHVIFSEKSENLSCITCKEGKQTRLPFKSECKRAQTPLQLVHSDICGPMETQTLGGSKYFITFLDDYSKKIYVYFLRNKSDALEKFKEFRNEVENQLEARIKVLRTDNGLEYVNNNFSDYLKSCGIIHQTTTPYTPEQNGTAERMNRSLIERAKCMLLNANLPKLYWADAVHTAAYIINRSPTKSLSFKTPEELWSGQKPYVKHMRIFGCEAMVHLPQEKRRKWDPKAQKMIFIGYCDHTKGYRFIIPNSRKVIKSRDATFLESTVKRDYVPIELSQKKPSMNIDDSKESETSEMTDDSTSTGSYDTVCDTKSSDSDYLPDRSYDSLPISNITLRRKKKVQQSSDDPEENTYLCQDEVMLLDVPETYKEAVNSIHKEKWMRSIDEELHAHQKNNTWTLVQRPANTKVINCKWVFRIKDEPTGPRYKSRLCAKGYAQTKGIDYNETFAPTVRYDSIRILLSVAAQNNLKVIQLDVKTAFLYGELEEVIFMSPPEGLPCEENMVCKLNKSLYGLKQAPRCWNSKFDTVLKKYGFVNTKADQCVIPVDPHVKLQKGNEEPNKSIPYRQAVGSLMHVAIVSRPDVMFAVSLNRQKLQATAMQTMQMIWITVDQLLAMFLSRMEQL

Summary

EMBL
KQ459875    KPJ19636.1    NWSH01002292    PCG68657.1    PCG68658.1    NWSH01000816    + More
PCG74073.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    JYDJ01000136    KRX42725.1    JYDJ01000808    KRX33413.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    GBXI01011094    JAD03198.1    JYDR01000001    KRY80095.1    KQ460882    KPJ11482.1    JYDH01000330    KRY26802.1    GAKP01015352    JAC43600.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    NEVH01006721    PNF37230.1    NEVH01002725    PNF41351.1    NEVH01019375    PNF22597.1    NEVH01006980    PNF36330.1    KL367628    KFD61291.1    GEHC01000867    JAV46778.1    KL367553    KFD64618.1    GEHC01000868    JAV46777.1    JYDQ01000379    KRY07987.1    GEZM01011855    JAV93396.1    LBMM01008124    KMQ89126.1    JYDK01000071    KRX78146.1    GEZM01011859    JAV93384.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GALX01001351    JAB67115.1    GEZM01045163    GEZM01045162    JAV77888.1    GBHO01020706    JAG22898.1    JYDU01000001    KRY01876.1    CM003608    KYP66219.1    KA648745    AFP63374.1    JXUM01099923    KQ564528    KXJ72133.1    NCKU01012701    RWS00004.1    CM007900    OTG08534.1    OIVN01001733    SPC97079.1    OIVN01006429    SPD32977.1    GEDC01002834    JAS34464.1    OIVN01001789    SPC97674.1    GDUN01000214    JAN95705.1    ASHM01014005    PNX95963.1    OIVN01000189    SPC75922.1    OIVN01001130    SPC90232.1    OIVN01000557    SPC82046.1    GBHO01024949    JAG18655.1    GBHO01024951    JAG18653.1    OIVN01002247    SPD01987.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    OIVN01001052    SPC89229.1    OIVN01001906    SPC98838.1    LBMM01012669    KMQ86061.1    OIVN01006468    SPD33689.1    OIVN01002854    SPD06945.1    GEHC01000879    JAV46766.1    OIVN01000404    SPC79669.1    OIVN01001666    SPC96375.1    OIVN01002261    SPD02091.1    GDHF01029191    JAI23123.1    OIVN01005068    SPD20708.1    OIVN01000036    SPC73022.1    GAMC01008189    JAB98366.1    GGFM01000953    MBW21704.1    OIVN01000486    SPC81000.1    OIVN01002564    SPD04723.1    GAMC01020355    JAB86200.1    GGFM01000952    MBW21703.1    GGFL01004951    MBW69129.1    OIVN01004879    SPD19723.1    OIVN01006120    SPD25513.1    OIVN01002444    SPD03657.1    OIVN01001534    SPC95017.1    OIVN01005591    SPD23209.1    OIVN01003569    SPD12194.1    JYDN01000113    KRX56900.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13961   DUF4219
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR025314   DUF4219        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR039537   Retrotran_Ty1/copia-like       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF118290   SSF118290       
Gene 3D
PDB
3DLR     E-value=0.000843972,     Score=105

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1016
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.42286
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00040
outside
1  -  1016
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.082771
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号