SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13649
Pre Gene Modal
BGIBMGA011037
Annotation
18_wheeler_[Operophtera_brumata]
Full name
Toll-like receptor 7      
Location in the cell
Extracellular   Reliability : 1.309 Nuclear   Reliability : 1.15 PlasmaMembrane   Reliability : 1.674
 

Sequence

CDS
ATGTACGCCATTGCAGCTGTGTTTTGTGCGCTGCTTCACTTCGGCTGGACTCTGATGCCGAACAACGCGGACAAATGCGCCCGTGTAACCGACAGAGGATTTGAATCGGCTGTCTGCAAGATCCGAACCCTTGAGAGCGAGGGAACTGCTATAGCTTCAGTATCCTCTGATACTAGCCGACTCTCTATAGAATGTAATCACCTGCTCTTCTTTGAAAGCTCTCTAAAGGCTCACTACTTTAAGCCCGTTCCAGGTCTTGTTGATTTGTCAATAAGCAACTGTAAGCTTCTAAGCGTACCAGACAACACATTCCATGGCCTAAGGAAACTTAAAAAGTTGCAACTAAGATCGAAAAACTTCGAGTGGAGCCCTACTAAGAATTTGGAGTTGTCTTTGAACGCGTTCAATGGATTATCGGAACTGCAGTCGTTGGATCTCGCTCAAAATAACATCAAATTCATTCCTTCCGGTGTGTTCTGCGTTTTGGAGAATTTAAACACACTCAACTTAACTTACAATCGAATCAAAACCGTTGGACAGATCGGCTTTGGACAAGGATGCGGATCTAGTTTACAAAGTCTGGATCTAAGTCATAATATGATTAAAACTATATCGGATGGTTCTGAATTGCTGAAATTAAGAAGTTTGCAACATTTATATCTACAGCATAATAATATCACCGACATATCAAATGAAGCATTTGACGGGCTTATATCTATGAGAGTTTTAAACATATCCCACAACCGCTTGCACACATTGCCCGAAGGACTGTTTGTGAATGCCAGAGAATTAAGAGAAATATACTTAAACGATAACAGCATTTATGAGTTGGCTCGAGGTATATTTCATCGTCTAGAACAGTTGATTGTTTTAGATATTTCGAGTAATCAACTTACGAGCAATCACATTGATGACGGCACTTTCTTGGGCTTAATCCGGTTGATCGTTCTGAATTTATCTAACAACGCACTAACAAGAGTGGACGGGAAAACGTTTAAAGACTTGTTCGTTTTACAAATACTTAATTTGAAAAACAACTCGATTGGATACATCGAAGATAACGCTTTTTTGCCACTCTACAACCTGCACACGCTCAATTTAGCCGAAAACCGTCTTCACACAATAGACGAGAATTTGTTCAACGGCTTATTTGTTCTCAGCAAATTGACCCTCAACAACAATTTACTCGTCAACATCGACCGTAAAGCATTTAAAAATTGCTCGGACTTAAAAGAATTGGACCTCAGCTCTAATCAGCTACTGGAAGTACCCGAAGCTTTGTGGGAGCTTCCGTTTCTGAAAACGCTCGATTTAGGAGAAAATCAGTTATCTAACTTCAGAAATGGCTCTTTCAAGAACTTGAACCAATTAACCGGCCTGAGGTTGATTGACAATCAAATAGGAAACTTGAGCGTCGGAATGTTTTGGGATTTGCCGAGTTTACAAGTTTTGAATATCGCAAAGAACAAAATTCTGTCAATTGAAAGAGAAACGTTTATTCGCAACACACAACTAGAAGCAATACGTCTGGACGGCAATTTTCTGTCGGACATCAACGGTGTTTTCTCAACGCTCGCGAGTCTTTTGTGGTTGAACTTATCGGAAAATCATCTTGTGTGGTTTGATTATGCGTTTGTGCCTAGTAATCTAAAGTGGTTAGACATTCATGGAAATTTCATTGAACATTTAGGCAACTATTACAAGTTGCAAGAAGAAATTCGTATAAAGACCTTAGATGTTAGTCATAATCGTATTTCGGAAATATCGCCAATGGCAATACCTAATAGTGTTGAATTACTGTTCATAAACAATAACTTTTTGAATGCAATTCATGTGAATACGTTTTTCGATAAAAAGAATTTGACGCGAGTGGATATGTATGCAAATGAAATCAATCATTTAGAATTGAATAGCTTACGTTTGTCGACAGTGCCGGGAAACAAAACACTACCGGAATTTTATATTGGCGGTAATCCTTTTCAGTGTGACTGTACTATGGAGTGGCTCCCAATTATAAATAATATGACCGCTATGAGACAATATCCGCGAGTGATGGACTTAGAAAATGTTTTGTGTAAGATGACAAATACACGTAGTGGAACGCATGTGCCCTTAACTAACCTTAAGACGACAGACTTTCTTTGTAAGTATGAGACTCATTGTTTTGCTATCTGTCACTGCTGCGACTATGATGCGTGTGACTGTGAAATGACCTGCCCTCACAATTGCACCTGCTACCACGATCCATTGTGGAACACAAATGTTGTCGATTGTTCGGGGCAATCTTCAATGGAAATACCACAGAAAATACCCATGGATGCAACAGAAGTGTTTTTAGATGGCAATAATATTCGGGAATTGCAGAATCACGTGTTTATCGGAAGACAGAAGATGAGAACACTGTATGTTAATAATAGTAACGTAGATAGCATTCAAAACAGAACTTTCTCTGGTTTGAACTCGTTACAAATACTGCACTTGGGTAACAATAAACTCAAAGAATTAAAAGGATACGAATTCCAACAGTTGAATAACCTAAAAGAACTATTCTTACAAAACAATCTAATCAGTCATATCGCAAACATATCATTTTTATCTCTTAAGTCCCTAGAGTTGTTACGCCTTGACGGCAATAGACTCGTAGACTTCGGAGTATGGAGCTTTAGTAACAATCTAAACTTGAAGGCATTATCATTAGGAAATAATTTGTGGTCCTGCAAATGTCGCTACCTGCAAGAGCTAACTGCGTTTTTGGCGGAGAATGCGCAAAAAATTATTGACATTACGGACGTGTGGTGTTGGAATGGCGACGCGAAACCGCCGCAGAAAAAAGAACTCAACTTAAATGGCACTGCCTGCAGCGATTATTACGCCGATAATTCAGTCATTGGAAACATGTTGGTCTCAAACTATGTTCCCATGATGGTTTCAACTCTAACCGGGTTCATGTTAATTTTACTGGCTCTGGTCCTGCTGTTTCTTTTTAGAGATTCACTGAGAGTGTGGCTGTATACAAATTGCGGCATTAGAGTGTTTTCGTTACCCGGAACTTTTGAGGAGAATCAAAAATTATACGACGCCTACGTTTGCTATAGCCCAAAAGACGAAGAGTCTGTCGTGCAGTCGTTAGTGAATGAGCTAGAAAACGGGAATCCATCGTACCATCTTTGCCTTCATTACCGTGACATTCCACATCACGGCGCTCAGTACATGCAATGCGCGCCGCCAGACGTCGAGACCGCGGAAGCATCCAAACGAATAATTATCGTCCTAACGAGAAATTTCATGCAAACCGAGTGGTCCCGATACGAATTCCGACAAGGTCTGCACGAAGCATTAAAAGGGTGTATTTATAAACTCGTTCTAATAGAAGAGTGTTCTGTGGTGGCGGACGCAATGTGCGACCCCGATTTACGACCCTACCTCAAGACGGGATCGCGGCTGAGGTGGGGACAGAAAGGGTTCTGGGAGCGTCTCAGGTATATAATGCCCGATTCGACGCATTCAAGCCATAAATCGCGATCTCATAGTTATAGAAGAAGTATTAACACGTATACATTAGATTCGTCTGTGCCTAACGGAGGGAATCGCACGATGGCTTTTCCTGATAAGTCGCCTGTGTTGGGAGTTGCGAATCAGGGGGCTAGTGCGCCACCGGAATACGTCACAGAGGTCCGACAGTCACCTTCTGTTGTTAGACAAACCCAGGGCGTCGCTTACGGGCCGGACGGCAGGCCGATCTCAGATCACATATATTCCTCGATAGATTCTGACTATTCATCCTTGGAACATGGTATGGCCCCGGGCAGGCGGCGAGACATCCGCCAGTGGCCCCCGCCCCCGCCTCTCGTCGACACGGGCAACGCCGTGCAAGCCTACCTAGTCTAA
Protein
MYAIAAVFCALLHFGWTLMPNNADKCARVTDRGFESAVCKIRTLESEGTAIASVSSDTSRLSIECNHLLFFESSLKAHYFKPVPGLVDLSISNCKLLSVPDNTFHGLRKLKKLQLRSKNFEWSPTKNLELSLNAFNGLSELQSLDLAQNNIKFIPSGVFCVLENLNTLNLTYNRIKTVGQIGFGQGCGSSLQSLDLSHNMIKTISDGSELLKLRSLQHLYLQHNNITDISNEAFDGLISMRVLNISHNRLHTLPEGLFVNARELREIYLNDNSIYELARGIFHRLEQLIVLDISSNQLTSNHIDDGTFLGLIRLIVLNLSNNALTRVDGKTFKDLFVLQILNLKNNSIGYIEDNAFLPLYNLHTLNLAENRLHTIDENLFNGLFVLSKLTLNNNLLVNIDRKAFKNCSDLKELDLSSNQLLEVPEALWELPFLKTLDLGENQLSNFRNGSFKNLNQLTGLRLIDNQIGNLSVGMFWDLPSLQVLNIAKNKILSIERETFIRNTQLEAIRLDGNFLSDINGVFSTLASLLWLNLSENHLVWFDYAFVPSNLKWLDIHGNFIEHLGNYYKLQEEIRIKTLDVSHNRISEISPMAIPNSVELLFINNNFLNAIHVNTFFDKKNLTRVDMYANEINHLELNSLRLSTVPGNKTLPEFYIGGNPFQCDCTMEWLPIINNMTAMRQYPRVMDLENVLCKMTNTRSGTHVPLTNLKTTDFLCKYETHCFAICHCCDYDACDCEMTCPHNCTCYHDPLWNTNVVDCSGQSSMEIPQKIPMDATEVFLDGNNIRELQNHVFIGRQKMRTLYVNNSNVDSIQNRTFSGLNSLQILHLGNNKLKELKGYEFQQLNNLKELFLQNNLISHIANISFLSLKSLELLRLDGNRLVDFGVWSFSNNLNLKALSLGNNLWSCKCRYLQELTAFLAENAQKIIDITDVWCWNGDAKPPQKKELNLNGTACSDYYADNSVIGNMLVSNYVPMMVSTLTGFMLILLALVLLFLFRDSLRVWLYTNCGIRVFSLPGTFEENQKLYDAYVCYSPKDEESVVQSLVNELENGNPSYHLCLHYRDIPHHGAQYMQCAPPDVETAEASKRIIIVLTRNFMQTEWSRYEFRQGLHEALKGCIYKLVLIEECSVVADAMCDPDLRPYLKTGSRLRWGQKGFWERLRYIMPDSTHSSHKSRSHSYRRSINTYTLDSSVPNGGNRTMAFPDKSPVLGVANQGASAPPEYVTEVRQSPSVVRQTQGVAYGPDGRPISDHIYSSIDSDYSSLEHGMAPGRRRDIRQWPPPPPLVDTGNAVQAYLV

Summary

Description
Toll-related receptor which binds to the neurotrophins NT1 and spz5 (PubMed:10973475, PubMed:23892553). Essential for antiviral autophagy, it detects and binds to the vesicular stomatitis virus (vsv) following infection (PubMed:22464169). This role is likely to be independent of the canonical Toll, immune deficiency, and JAK-STAT signaling pathways (PubMed:22464169). Functions in olfactory circuit assembly by promoting synaptic partner matching between olfactory receptor neurons (ORN) axons and projection neurons (PN) dendrites partners in the antennal lobe (PubMed:25741726). Function in the Va1d ORNs is necessary and sufficient for correct targeting to their partner PN dendrites (PubMed:25741726). Also involved in the targeting of other classes of ORN axons (PubMed:25741726). Functions with Toll-6 to regulate motor axon targeting and neuronal survival in the central nervous system (CNS) (PubMed:23892553). May be an upstream component of the NF-kappa-B (rel) regulatory cascade (PubMed:23892553).
Similarity
Belongs to the Toll-like receptor family.
Keywords
Cell membrane   Complete proteome   Developmental protein   Disulfide bond   Immunity   Innate immunity   Leucine-rich repeat   Membrane   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Toll-like receptor 7
EMBL
BABH01019412    AB070579    BAB85498.1    ODYU01005119    SOQ45671.1    NWSH01001862    + More
PCG69881.1    JTDY01003195    KOB69977.1    KQ460473    KPJ14395.1    MH243026    AXS59160.1    AGBW02010899    OWR47539.1    KZ149988    PZC75639.1    ODYU01008633    SOQ52385.1    BABH01019375    JTDY01001788    KOB72878.1    KPJ14394.1    KQ459595    KPI95821.1    GEZM01011983    JAV93317.1    KQ971311    EEZ99327.1    ACPB03002369    GDHC01002096    JAQ16533.1    GEDC01004297    JAS33001.1    PYGN01018333    PSN28975.1    KC355236    AGK40936.1    KX086263    KK854062    ANG08886.1    PTY10520.1    NEVH01011197    PNF31811.1    APGK01021779    APGK01021780    KB740363    ENN80811.1    DS235819    EEB17714.1    KB631964    ERL87512.1    KK852574    KDR21050.1    KX086267    ANG08890.1    GBYB01008155    JAG77922.1    GGMR01003079    MBY15698.1    ABLF02028882    GFXV01002236    MBW14041.1    NWSH01000423    PCG76493.1    CM000071    EAL26021.2    JTDY01006633    KOB65817.1    OUUW01000001    SPP75502.1    CH479181    EDW32586.1    ODYU01013217    SOQ59911.1    ATLV01023858    KE525347    KFB49716.1    AF247765    DQ138914    AE013599    BT125656    AAF86225.1    ABA86520.1    ADN32842.1    CH480816    EDW48643.1    CM000362    CM002911    EDX07855.1    KMY95189.1    CM000158    EDW91449.1    DQ138916    ABA86522.1    DQ138919    ABA86525.1    DQ138915    ABA86521.1    CH954179    KQS62206.1    EDV55258.1    DQ138917    ABA86523.1    GBXI01004062    JAD10230.1    GDHF01031799    GDHF01030188    JAI20515.1    JAI22126.1    MH243027    AXS59161.1    DQ138918    ABA86524.1    GAMC01019149    JAB87406.1    HQ852232    ADV41489.1    CP012524    ALC42769.1    CH940648    EDW60302.1    DS232609    EDS44003.1    CCAG010007790    JXJN01003494    CH902619    EDV36849.1    CH916375    EDV98276.1    KQ459597    KPI94753.1    CH933808    EDW10441.1    CH963850    EDW74839.1    KPJ14406.1    JRES01001589    KNC21654.1    AXCM01003257    KQ982629    KYQ53430.1    AAAB01008986    KQ981856    KYN34631.1    APCN01003296    EAA00348.4    KQ976440    KYM86510.1    ADTU01005045    AJVK01058481    GL438820    EFN68383.1    GL446009    EFN88591.1    JXUM01065388    KQ562345    KXJ76106.1    AXCN02001040   
Pfam
PF13855   LRR_8        + More
PF01582   TIR
PF13306   LRR_5
PF00560   LRR_1
PF13516   LRR_6
PF13676   TIR_2
Interpro
IPR032675   LRR_dom_sf        + More
IPR035897   Toll_tir_struct_dom_sf       
IPR000157   TIR_dom       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR000372   LRRNT       
IPR026906   LRR_5       
IPR000483   Cys-rich_flank_reg_C       
SUPFAM
SSF52200   SSF52200       
Gene 3D

Ontologies

Topology

Subcellular location
Cell membrane  
SignalP
Position:   1 - 23,         Likelihood:  0.900784
 
 
Length:
1295
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
25.19204
Exp number, first 60 AAs:
2.12128
Total prob of N-in:
0.11592
outside
1  -  972
TMhelix
973  -  995
inside
996  -  1295
 
 

Population Genetic Test Statistics

Pi
244.233917
Theta
211.983452
Tajima's D
0.637163
CLR
0.117354
CSRT
0.555772211389431
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号