SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13633
Pre Gene Modal
BGIBMGA000981
Annotation
PREDICTED:_uncharacterized_protein_LOC105841932_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.137
 

Sequence

CDS
ATGCCAAGGGTACGCCAAAGAAAGACTACGAAAGGTCGGGCAGACTTATCAACGTATAAACAAGCTTATGATGATGTAAAAGCGGGATCGTCGTTAAGAACAACGGCAGAAAAACATGGACTGAACCACTGTTCCCTGTTCCGATATGTACATAAACGAGATGCGGCTGGTAACGACGAAAATCAAGAAATGGGATATAAGGCCCACAATCGGGTGTTTACCCGGGAACAAGAGCTTGAGTTATCTAAATATTTAATCAGATGTGCAGATATATATTTTGGCCTAACTAAAAAGGATGTCATGAAATTGGCATACGAACTAACCGTCAAGTACAACTTATCACGACCTCGGACTTGGGATGACAACGGAATGGCTGGCGAAGAATGGTTTCGCATGTTTATGAAAAGAAATTCTGAACTGTCAGTACGTGCAGCACAAGCCACAAGTCTTTCTAGGGCGACTAGCTTTAATAGGAAAAACGTAGATGCTTTCTACGACAATTTGGCTAATGTTATGGACCGCTACAAATTTGAACCACAAAATATCTATAATGTTGATGAGACTGGCATAACTACTGTGCAAAAACCCGACAGAATTATAGCTAGACGTGGTGCTCGTCAAGTAGGCTCAGTAACTTCGGCGGAGAGGGGTGCTTTAGTTACAGTAGCCATTGCGGTCAATGCCATCGGAAATGCTATTCCTCCGTTCTTTGTCTTTCCGCGAGTACGATACCAAGATCACTTTGTCAGGGATGGGCCAATAGGATCTGCTGGGAGTGCAAATCCTTCTGGCTGGATGCAGGATGAATCATTTATGCATTTCCTGGATCACTTCAGGAAACATACGAATGCTTCTCCTTCGCGTATAATTTTACTTGTGCTTGATAACCACTCGTCACATATACACATTAACGCACTAGACTTTTGCAAGACGAATGGTATTGTAATGCTATCTTTCCCTCCCCACTGCTCACACAAACTCCAACCACTTGATCGATCTGTATTCGGTCCACTAAAAAAAGCTGTAAATTCGACCTGCGATGGATGGATGCGAAGCCACCCCGGAAAGACAATGACAATATACGACATTCCAGGGATTTTAACTACTGCTATGCCGCTTGCTCTTACACAATCCAATATTCAAGCTGGCTTTCGCACAACTGGGATTGTTCCATTTAATCGACATTTGTTTACTGAGCTCGATTTTGCACCTGCCTTTGTGACAGATAGGCCAAATCCATTAGAAGCAGCTGATGGTCCTATTCAGAATATTAATACACTTGAGGATAAAACGCCACCAACATCACCTTCCATTTTAACCCTCGAACCACAAGAAGAGATGGAGGAGCTTTCTAATGAAGCTCTTCTTGTACAACAACCGACTGAAAATATGCCACAATGTTCACAAGTACTTGATAAAGAACAGGAAAACATTATTGCAAATCCAAAACTTTTGATTATATTACCCGGACATGAAAGTAGTAGTAGCGCTCAGCAAATTTCACCCAAACCCTCTAAAAGTTCTCAATCCATTCCTGTGTTAACAACTCAAACGGGAAGTATCATGACTTTGACTACACCATCTTTATTTTCGCCAGAAGTAATACGACCACTACCAAAAGCTCCTCCAAGGAAATTAACAAATAGGGGCCGAAAAACCAGGAAATCTACTATCTACACAGACACACCTGAAAAAGAAGAGATAAGAAGAGAATATGAAAACAGATTGAAACGAACCAAAGCTAAACAAGTTAAGAAAAGATTAGATGGGGGAAAGACTAAAACAAATGCTAGAAGCAGGGGAAAAATTAAGATGCACCAAGAGTCATCATCATCAGAAGAAGAGGAGTGCTACTGTGTTGTTTGTATGTCAGCATATTCAGAAAGCAGACCCAGGGAAAAATGGATACAATGCACAGTATGTAAAATGTGGGCGCATGAAGAGTGCACACAAGGTAGCCTTAGTTATGTTTGTCACAATTGTGACTCCGAATGA
Protein
MPRVRQRKTTKGRADLSTYKQAYDDVKAGSSLRTTAEKHGLNHCSLFRYVHKRDAAGNDENQEMGYKAHNRVFTREQELELSKYLIRCADIYFGLTKKDVMKLAYELTVKYNLSRPRTWDDNGMAGEEWFRMFMKRNSELSVRAAQATSLSRATSFNRKNVDAFYDNLANVMDRYKFEPQNIYNVDETGITTVQKPDRIIARRGARQVGSVTSAERGALVTVAIAVNAIGNAIPPFFVFPRVRYQDHFVRDGPIGSAGSANPSGWMQDESFMHFLDHFRKHTNASPSRIILLVLDNHSSHIHINALDFCKTNGIVMLSFPPHCSHKLQPLDRSVFGPLKKAVNSTCDGWMRSHPGKTMTIYDIPGILTTAMPLALTQSNIQAGFRTTGIVPFNRHLFTELDFAPAFVTDRPNPLEAADGPIQNINTLEDKTPPTSPSILTLEPQEEMEELSNEALLVQQPTENMPQCSQVLDKEQENIIANPKLLIILPGHESSSSAQQISPKPSKSSQSIPVLTTQTGSIMTLTTPSLFSPEVIRPLPKAPPRKLTNRGRKTRKSTIYTDTPEKEEIRREYENRLKRTKAKQVKKRLDGGKTKTNARSRGKIKMHQESSSSEEEECYCVVCMSAYSESRPREKWIQCTVCKMWAHEECTQGSLSYVCHNCDSE

Summary

Pfam
PF03184   DDE_1        + More
PF03221   HTH_Tnp_Tc5
PF05225   HTH_psq
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR003599   Ig_sub       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR036179   Ig-like_dom_sf       
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR007889   HTH_Psq       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR002219   PE/DAG-bd       
IPR009057   Homeobox-like_sf       
IPR007110   Ig-like_dom       
IPR019786   Zinc_finger_PHD-type_CS       
SUPFAM
SSF48726   SSF48726        + More
SSF57903   SSF57903       
SSF46689   SSF46689       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
664
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.33847
Exp number, first 60 AAs:
0
Total prob of N-in:
0.58735
outside
1  -  664
 
 

Population Genetic Test Statistics

Pi
172.503875
Theta
157.908886
Tajima's D
-1.319342
CLR
126.167759
CSRT
0.0857957102144893
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号