SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13630
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.938
 

Sequence

CDS
ATGCCATTTGGCCTTAAAAATGCACCTACAACATTCCAAAAACTCATGAACAATTGTCTTTCTGGCCTACAAGGTAATAGGTGTTTCGTTTATCTCGATGATATTGTTATATATAGCTATGATCTTAAATCACACATCAATAACCTCAGTAAGGTATTTGAGAGAATCAGGAACTATAACTTAAAGTTGCAACCGGAAAAATGCGAATTTCTCCGGAAAGAAGTAGGGTATCTAGGTCATATTATCAACGAAGAAGGAGTAAAACCGAACCCTGATAAGATCCAAGCCGTGGCAAAATTCCCCACACCGAAGTCACCGAAGGATATAAAATCCTTTCTAGGACTTGTCTCTTACTATAGACGTTTTATCCCCGATTTCTCTAAGTTAGCCAAACCCCTGACATCCCTTCTTAAAAAGGACACTGCCTTCAACTGGCAAAATGAACAACAGTTATCCTTCGAAACACTAAAATCCAAACTCATATCAGCTCCTATCCTAGCGTATCCTGACTTTTCACAACCATTCCTGCTTACCTGCGACGCTTCAAATTATGCCATTTCCGCCATCCTATCCCAAGGGCAGATCGGAAAAGACCGTCCTATCGCGTTTGCATCTAGAACCCTCAACAAAGCGGAATGCAACTATAGCGTGACGGAAAAAGAGTGTCTCGCAGTAATTTTTGGAACAAAAACCTTTAGACCATACATCTACGGTCATCATTTTACTGTCATAACAGACCATAAGCCTTTAGAATGGCTATTTAGATGTAAAGATCCTGGTTCTAGGCTTGTACGCTGGAGACTTATCCTAGAAGAATTTGAGTACGATATTAAATATAAAAAGGGAAAGCTTAATACAAATGCCGATGCATTATCCCGTTTTCCGGTAAATCCCATCCAGCCTGTAAACCTTCCTGAATCAAATCAAATTATTGAAGATCGACAAAGTATGAGGTTAGATGAAAATTTGATGGACTTACTAATACCACCACCTTCATTTAATCCAGATGAAATAACCAACTTATCCCCAAATCCTTTATCCGCCGAAGAACACGCCTTTAGTCCGTTAACACTGAATGATCTCGACGTCCATGCTGGTTCCTCTCCTACATTTCTTGATCTTGATGATATTAATGCTCGAAAGAATAGTTCATCAGAAAACAAAGCCCCTGGCAAACTTAACGATGAAAATCCATCCTCATCCGTTCGACAACACCCCACGACGGACAGCTCATTAATAGGAAGTTCACCTTCTTGTATCCCTAGGAAAATCTCCACAAACACTAACTCTTCTACACCTTCTGATGTAAATACAGAAAACCCAATTTCTCGATCCCCAGTAGAACAACCTCGAGACTCAGACTCGCCAATAGAAAACGCTATAATGACTGACGACTACTCCGTTTTCCTCAAATCTATGTCAGATCCTAATAAACATTATAATGTACAGATAGAAGAGCATAATCAAAACCTATTAAAAGGCCAATCGAAAACACTCTTAATACCTACCTCAATCGATCTCGACGAATCCAACCCTTATGTTCAAGAAATCATAGGTAATTTGCCGACTGGCAGCAATATACCTAACATCGAAAAAGAATTACACTCCTTCTGTAAAATTGACTCAAATAATAAAACTTTTTACTTAATTTTCATTAAAGTTCACCATTTTGATGAAGCTTCATATCCCGAAATATTCGAGACCCTTAAACGCATCCGCAATGAATTATTAATAAATGATAATACAAAGGACATAGGAATAACAGATTTCAAAAATCCATTTGAAAAACATTCGTTTGTTAAAATTTATAATATGTTAAGTTATCTATTCCATAATACAGAGATCAAAATTAATATATATCATAATAATGTAACCTACCCGTCTCCAACGGAGATTAAGAAAATCTTATTCGACAATCATGATATCCCAATTGCCGGACACCTCGGCTCAAATCGTATGTTCAACCGGATTAAGGAGAGTTATTATTGGAAAGGTATGCGTAGCGACATTGAAGCCTATGTTAAACAATGTAAACAGTGTCAAGAAAATAAAGCGTTGAGGAAAATTAACAGAGCCCCGATGCAGATCACTAGTACGTCAACTGCACCATGTCAACGCATATCCCTTGACATCGTCGGTCCATTGCCAGAAGCAGGTCCTGCAAAATTGAAATACATCCTAACCGTCCAAGATGATCTAACGAAATTCTCCACTGCATATCCCATCCGAAGTACAACCGCCGAAGAAACCAGCGAATGCCTCCTTCACTTCATTTCCATTTTCGGTATCCCAAAAATTATCCTAACTGACCAAGGCACAAATTTTACTTCCGAATTATTCCAAAGAACTTGCAATTTCCTTAAGATCAAACAGTTATGGTCATCGCCCTACCATCCCCAGACCCAGGGTGCACTTGAGAGGAGTCACTCTACCCTCAAGGAGTATCTCAAGTCGTATGTGAACGAAGGCCAAGATAACTGGCCCCGCTATGTTTACACCGCGATGTTAGCATATAATACGGCCGTACATTCAACAACTCATTTTACACCGTACGAGTTAATGTTTGGAAATAAACCTTTCATACCAAATTCAGTCTTCCAAGAACCGACCGGAACGACATATCCCGAATACGTCCGGATGCTCCAAAATCGATTAAAATACTCTCGTCAAAAAGCAGTAGAACATATCCAGAAATCCAAGGGCATATCTAAAACATACTATGACTCGCGTAGTCGCCCAGCATATTACCAAACCGGAGATTACGTATATCTCAAAAATCACCTGAGATCAAGAAAAGCCTTATCACCTGTATGGAAAGGCCCTTACAGGGTGATTAAAATACACGGTAACAATACTTTATCACTATTGATAAACCGTCGTCACGTGCGACACCATTACGATGAAATTAAGCCCGCGACTTTGAATGAAAACGTATAA
Protein
MPFGLKNAPTTFQKLMNNCLSGLQGNRCFVYLDDIVIYSYDLKSHINNLSKVFERIRNYNLKLQPEKCEFLRKEVGYLGHIINEEGVKPNPDKIQAVAKFPTPKSPKDIKSFLGLVSYYRRFIPDFSKLAKPLTSLLKKDTAFNWQNEQQLSFETLKSKLISAPILAYPDFSQPFLLTCDASNYAISAILSQGQIGKDRPIAFASRTLNKAECNYSVTEKECLAVIFGTKTFRPYIYGHHFTVITDHKPLEWLFRCKDPGSRLVRWRLILEEFEYDIKYKKGKLNTNADALSRFPVNPIQPVNLPESNQIIEDRQSMRLDENLMDLLIPPPSFNPDEITNLSPNPLSAEEHAFSPLTLNDLDVHAGSSPTFLDLDDINARKNSSSENKAPGKLNDENPSSSVRQHPTTDSSLIGSSPSCIPRKISTNTNSSTPSDVNTENPISRSPVEQPRDSDSPIENAIMTDDYSVFLKSMSDPNKHYNVQIEEHNQNLLKGQSKTLLIPTSIDLDESNPYVQEIIGNLPTGSNIPNIEKELHSFCKIDSNNKTFYLIFIKVHHFDEASYPEIFETLKRIRNELLINDNTKDIGITDFKNPFEKHSFVKIYNMLSYLFHNTEIKINIYHNNVTYPSPTEIKKILFDNHDIPIAGHLGSNRMFNRIKESYYWKGMRSDIEAYVKQCKQCQENKALRKINRAPMQITSTSTAPCQRISLDIVGPLPEAGPAKLKYILTVQDDLTKFSTAYPIRSTTAEETSECLLHFISIFGIPKIILTDQGTNFTSELFQRTCNFLKIKQLWSSPYHPQTQGALERSHSTLKEYLKSYVNEGQDNWPRYVYTAMLAYNTAVHSTTHFTPYELMFGNKPFIPNSVFQEPTGTTYPEYVRMLQNRLKYSRQKAVEHIQKSKGISKTYYDSRSRPAYYQTGDYVYLKNHLRSRKALSPVWKGPYRVIKIHGNNTLSLLINRRHVRHHYDEIKPATLNENV

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=2.01715e-43,     Score=446

Ontologies

Topology

Length:
978
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00245
Exp number, first 60 AAs:
0.00081
Total prob of N-in:
0.00005
outside
1  -  978
 
 

Population Genetic Test Statistics

Pi
136.263946
Theta
14.113286
Tajima's D
1.238017
CLR
26.829388
CSRT
0.725963701814909
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号