SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13616
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.089
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACACCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTTAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACAAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCACTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGATGATATTAGGGAACTCCTTAAAGCTAAGAACGCCTCGATACGCGCCTACGATAGGTTAGCCGTTGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGTTCGCCGTGCAACCTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDLDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTTEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLKAKNASIRAYDRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLGNRTRRTRQRVRRAT

Summary

Subunit
The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
Similarity
Belongs to the histone H2A family.
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF16211   Histone_H2A_C
PF00125   Histone
PF05699   Dimer_Tnp_hAT
PF14291   DUF4371
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR032458   Histone_H2A_CS       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
IPR025398   DUF4371       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR006580   Znf_TTF       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF47113   SSF47113       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
Length:
372
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07666
Exp number, first 60 AAs:
0.05283
Total prob of N-in:
0.12635
outside
1  -  372
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.429101
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号