SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13613
Pre Gene Modal
BGIBMGA011048
Annotation
reverse_transcriptase_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.585
 

Sequence

CDS
ATGGTAAATACCCGCAGTACCGCCAACAAACAAAGAAAAAACGACGATGAGTATGGCGCAAAAAGTTCTTGTGCCGCGAGTGCAGTGAAATCGGAACGAACCGAGAAACAAAATCCGCCTTCACTAGCATCACGTCAGTCAGTCAGGTCCAAGAAAATGTCATCATCAAAATCAATACAAATCCAGAAAAAGAAACTGGAACTAGAAGCAGCTCAGGCGAAAGCGCGTATTCAAATGGAACTCATTGATCAAAAGTTAGCGGCAGATCTAGCAGAACTCGAAGAAGAATACAGTCCACCATCAGAAATATCGGAGAAAAACAACGGCGGTGATATAGAAAAATGGTTAGAGCGTAGTCAACAGGAACTGCAGCAGGCCACTAAGCTCAACAGTGATAAACACAAGTCACACTCAAGCCCGGCCGACAACGACGCAGTTCAACAACTCACGAGCGCATTCAAAGAATTTATGACGTCCTCCGCCATCCAGCAAAATACTAAGCTGCTTAGTCGTCTCAGCACTCCAAAAGAACTCCCTATCTTCAGCGGAGACCCAAAAGAGTGGCTACATTTCGAGCAGGCCTACCGGGAATCGACTGAAGTCTGCAACTTCAGCGATCAAGAAAACCATTGGCGGTTACGAAAGTGTTTACGAGGTACCGCACAAGAAGCCGTCGCCGGCCTACTTATCAGTGGTGCTTCTCCTGCAGAAATAATTTCCACTTTAAAACTACAGTTCGGAAACGCTGACGTCATCCTATCTCGCATCGTGGTAGACGTAAAGAAGATGAACCCACTGCCTACGGACTACCACAAAGAAATAGTACCCTTTTCAGGCAAAGTGAAAAATTACGTGGCCGCTGTACGAGCCCTTGGTCGCCAAGAGTACCTGCAAGGCATGGAAGTGGCTAACATTATCTTATTCAAGTTACCCACGACCCTGCTCACCAAGTGGACAGATTATAGTTATCCGCTTATCACAGCTGAATCGCCGAAACCTAGACTAGAGTTGCTGTCAGATTTCCTCACCGAAGAAGCTATAAAAGTATCAACCTGTAGTGCTACCTTATTGCAATCTAGGACGGACAATTTCAAACGTAAACTTTATGATAAAGTGAACAATATACAAACAATTTTAGTGCAAGACGGACAAACGCTCCGCTGGCATTACAAGTGGGACTGCGCGGCCGCCACGAACGTCTTCGTGTGCGCGGCGCGTGGAACGATACAGAATTAG
Protein
MVNTRSTANKQRKNDDEYGAKSSCAASAVKSERTEKQNPPSLASRQSVRSKKMSSSKSIQIQKKKLELEAAQAKARIQMELIDQKLAADLAELEEEYSPPSEISEKNNGGDIEKWLERSQQELQQATKLNSDKHKSHSSPADNDAVQQLTSAFKEFMTSSAIQQNTKLLSRLSTPKELPIFSGDPKEWLHFEQAYRESTEVCNFSDQENHWRLRKCLRGTAQEAVAGLLISGASPAEIISTLKLQFGNADVILSRIVVDVKKMNPLPTDYHKEIVPFSGKVKNYVAAVRALGRQEYLQGMEVANIILFKLPTTLLTKWTDYSYPLITAESPKPRLELLSDFLTEEAIKVSTCSATLLQSRTDNFKRKLYDKVNNIQTILVQDGQTLRWHYKWDCAAATNVFVCAARGTIQN

Summary

Pfam
PF03564   DUF1759
Interpro
IPR005312   DUF1759       

Ontologies

Topology

Length:
411
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0869599999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.06492
outside
1  -  411
 
 

Population Genetic Test Statistics

Pi
139.886035
Theta
75.263243
Tajima's D
0.879675
CLR
0
CSRT
0.628718564071796
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号