SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13607
Pre Gene Modal
BGIBMGA006778
Annotation
Uncharacterized_protein_OBRU01_16492_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.881
 

Sequence

CDS
ATGGTAGAGAGCCAGGAGGTGCTTTCCCATTTAATAGGAAAGCGTCGTTACGTCAAAGGCTCACTTACAAGACTCTATAACCAGTTGGGAGAAACCGAAAGACTGTCTACGGAAACTATACAATGCCGCTTAGAGCGTTGTGTTGTAGCGTTCCGCGAATACGGCGATTATTGCGGCCGAATTCTGGCAACTAACCCGGCTGATGAAGAGGATTCAGGTGAGTACGATGACAAATATTTTGGCATCATGGCTTGCTACCAAGCTGAGCTTAACAAGCGAAAGGCCAATGCTCCGCCTAATCCGACACCCCAAAAAAGGCTTATAAAGTTACCTACCATAGAAATGCCGCAGTTCACGGGTCAATATTCGAAATATATCACATTTAGAGAAATGTTCAAATCAGTTATCGAAAATGATGTTTCTTTAGATGACATTCAAAAACTGCATTATTTGCGATCATTTTTAAAGGAAGAACCTTTAGATTTAATAATTAATTTGCCTCTTATAGGGTCCAGCTTCAAGGAAGCTCTGAGGTTACTGGACCAGAGATATTATAATAAATATAATATAATGACAGAGCTTTTGTCTACATTGCTAGATCTAGATGTTATTAGTAAACCTTCTCCTAGCAATATAAGACATTTTGTGTCAACAATTAAACAAACGTTGGCTGCCCTCAAAAATATGGAGGCGAAGGTAGATGAATGGGATCCAATTTTAATGTTGATTTTGACCCGCAAGTTAGATGAACGTACAGCACGCGAATACCAACTGGATCGGGACAACACAATGGACCCCACTGTGGACCAGCTTCTAGCGTTCCTTGAAAAAAGAGCGCTCGCTATGGAGAATGCTGGACAATCCGCAGCCAAGTTGTTTACCACCAAAGTAGTCAACGCAGTGACCGCTAAGGAGAAGCGAGGATGTTCAATTTATGTAGTGGACTGTATTATTAGGATGGGCAAGGAACTTGTTAAATAA
Protein
MVESQEVLSHLIGKRRYVKGSLTRLYNQLGETERLSTETIQCRLERCVVAFREYGDYCGRILATNPADEEDSGEYDDKYFGIMACYQAELNKRKANAPPNPTPQKRLIKLPTIEMPQFTGQYSKYITFREMFKSVIENDVSLDDIQKLHYLRSFLKEEPLDLIINLPLIGSSFKEALRLLDQRYYNKYNIMTELLSTLLDLDVISKPSPSNIRHFVSTIKQTLAALKNMEAKVDEWDPILMLILTRKLDERTAREYQLDRDNTMDPTVDQLLAFLEKRALAMENAGQSAAKLFTTKVVNAVTAKEKRGCSIYVVDCIIRMGKELVK

Summary

EMBL
JTDY01003385    KOB69639.1    BABH01003797    BABH01003798    JTDY01001733    KOB73051.1    + More
GEZM01103137    GEZM01103136    JAV51535.1    GDQN01000847    JAT90207.1    JTDY01001504    KOB73710.1    RSAL01000210    RVE44241.1    GDQN01011628    JAT79426.1    KQ981073    KYN09793.1    GALX01002427    JAB66039.1    GALX01005110    JAB63356.1    KQ977342    KYN03430.1    GEZM01012999    JAV92824.1    KQ982464    KYQ56128.1    KQ977032    KYN06203.1    JTDY01011642    KOB54794.1    KQ977959    KYM98432.1    KQ982064    KYQ60564.1    KQ977963    KYM98425.1    JTDY01001654    KOB73239.1    KQ981002    KYN10407.1    LBMM01018814    KMQ83686.1    ODYU01008608    SOQ52337.1    KQ978178    KYM96586.1    KQ973442    KXZ75531.1    JTDY01003341    KOB69703.1    JTDY01006572    KOB65881.1    ODYU01008829    SOQ52773.1    KQ976954    KYN06860.1    KQ978056    KYM97755.1    JTDY01001855    KOB72712.1    GGMR01015704    MBY28323.1    KQ978855    KYN27942.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    KQ978790    KYN28351.1    LBMM01005768    KMQ91221.1    KQ979276    KYN22031.1    KQ460036    KPJ18393.1    KQ981127    KYN09299.1    JTDY01006550    JTDY01002030    JTDY01001260    KOB65898.1    KOB72276.1    KOB74365.1    BABH01004450    GEZM01055231    JAV73081.1    BABH01022219    BABH01022220    KQ978164    KYM96665.1    KQ460500    KPJ14270.1    KQ982204    KYQ59009.1    NWSH01001201    PCG72150.1    ABLF02011452    GFTR01008874    JAW07552.1    GGMR01007417    MBY20036.1    ABLF02028302    ABLF02041631    GAIX01014054    JAA78506.1    KQ434810    KZC06736.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    ABLF02034472    ABLF02034478    ABLF02037563    ABLF02037568    ABLF02037575    KQ982228    KYQ58867.1    GBBI01004211    JAC14501.1    KQ979016    KYN24380.1    ABLF02022810    PYGN01002987    PSN29774.1   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05585   DUF1758
PF05380   Peptidase_A17
PF00665   rve
PF17921   Integrase_H2C2
PF05699   Dimer_Tnp_hAT
Interpro
IPR005312   DUF1759        + More
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001969   Aspartic_peptidase_AS       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041588   Integrase_H2C2       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR008906   HATC_C_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
326
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00358
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01205
outside
1  -  326
 
 

Population Genetic Test Statistics

Pi
318.514444
Theta
178.234919
Tajima's D
2.476175
CLR
0.044815
CSRT
0.943402829858507
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号