SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13600  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010958
Annotation
Uncharacterized_protein_OBRU01_08225_[Operophtera_brumata]
Full name
Nuclear pore complex protein       + More
Nuclear pore complex protein Nup107      
Alternative Name
Nucleoporin Nup107
Location in the cell
Cytoplasmic   Reliability : 2.173
 

Sequence

CDS
ATGGATAATACTTTGCAACTACATTCAACACAGTATACTCCTTTAAGAAATAAGAGAAGCCGACATTTACTACAGAGAGAAGAGACGTTAAATGTTTCGCCTATTTTGAACGATACTTCTATTTTTAAAAACTTAAATGATTCGAGTTTACGGCATGTACTTGATGAATCTTCCATATTGGCGAATCCCAGTAGCACGGGAGATCATTTGAGCGAAGAATTCTTCGAGATAATACAAAGCAGTAGACCTAGCAGTGTTTTAGATACATTAGCAAGGTTAGCTCAGGTATGTTGTGATTCGTTAGAGTTAATCGAGCCATGGAACAGATATAACGTCCACAACTACTGGTTGGCAGAGGAAGCCAACACATGGAAACTAATACATTGCCTGTACGCAGATTCAATCTCAGAACATCCAGAGTCTTTGGAAAATTTAGTTACTGAAGCAACACTATCACAGCAGAGCTTAGTGAATGCTCTATTTAGAAGTGATTCTGAACTGAGACTGTTGCAGCTTCTGGTAGACTGGTTGGAAGCAACTGCTGCTTATCAAGAGGAAGCGACAAAAACTTCAGCACCTGTCATTGGAAATAACATACACTGGGGCAACACTTTACATGAACTGCTGATTGGAAATAGTCTATTCAACAAAGAAAAAAACAAGTCTCTAGTCACATGTATGGATCCAGATGCACCAAGAAGACAAAATAAATCTATACACTCTGATGATATGAAAGATGACAGCGATTTATGTAAACGCATATTTACTGAAGTCCGTTGTGGTAAATTTCAAGAAGCAGTCTCATTATGCATAAGTGCTGGTCAAGCATGGCGAGGAGCAGTACTACAAGGTTGGAAATTATTACATTATTTGCCCAAAGATGATCCAACTGATCCATTAGAAATTCAAGGGAATCCTTCAAGAGACCTTTGGAAATGGTGTGCCCTAGGAATTGCTAATTGTGCATCTGAAAATATCTACTACAGAGCGACAATTGGTATTTTGAGTGGCCACCTGCCTAGTGCACTTCTAGCTTGTCAAGGTAGCTGGGAAGACATTCTATGGGCTCATTTGAAAATACAAATAGAAGTTAGAGTTGACAAGTTTCTCCATGAACATCATTTAACTGTTGATGCTAACACTACACCTTCAGATGTGCTGGACCTATTACAAGCTGAATTTCAAACAGATGAAATATCTTTACAGCAAGTATTTAGTGCAGTAAAGTCTCTGATGGATGGAAAACGTGAATCGAACTATCAGTTGTGTCAGCGTTATTTAATGCTTGGTCAAGTAAGAACAATAATGTTAAATTCATTAGAATGGCTAGAAAATGCTAATGAGAGGTTTATTCGATTTTTAGCACATCTCATATTAGTATTGAGACAAATGGGTAAAGATCCTCAGCATGATGTTGGTGACCAAGTCTTGGAAAAGTATGTGACATTACTTACCATTAGATTGGTTGATGGATCTGTGGAGTCCCCAGAGCTTATAGCATATTACACTTCTACAGTTCCAGCCGAAAAACAAATCATTCTGTATGCAAACTTTATGGACCAAATTCACAAAAGTGATTATAGGCAAGGTGTTGTAAAAGCTGGGTTGGATGCTGGAATCGATGTTGGTGCATCAGCTCGCGTGGCTATTAAGAAAGCTATTGCAGATATACAACAAGGATATGGAAATGTAGAATTGAACTTCACACAGACAAGTGTTATAGAAAAGGATAAAACATTGATATCCAAAGTTATTTCTTCTTTAGAATGGTTGGCTTTAGTTGACAATCAGCTTGAAGAAGCACTATGGTTGAATAATGCAATGATCAGAACATTTATATTCATTGGAAACACTGATGCTGCCAATGCATGTCTGACTAGCTTCAACAAAATGTTTTCTAACTTTATAAACACAGTTGATTCAAGTACCTCTGAACTAAGAGAACATTTGTGTTTAAAAGCATACTTGGATGCTCTCGAGGGATTTGCAACTTGGTATAGACATTTTATAAGTGGACAACCTAAAGATGTGCAGCCATTACCACCAGATGCAACATTTTCTGATAAAGTATATCATGAACAGCAATGTGCACAAGTTGAAAAGAAGAAAGCAATATGGATTAATGCAGTTTCACATCAATCAAGACATACCAAAAGCTTACTATACAATGTTTTACTGTTTCCAGGAGGTTGGTTGCAAGATGAGAGTGATAGTACATCATCAGACAATTTCAACCAGGAAGAGAAAACAGAAAGATTAAAACAGTTGGACACCCTTAGACGACTTTGTGTGCCAGAAATTGTGATTTTATTACTAAAGATTTTACAGAGTAATGAGGATATTGAGAGTCACAAGGAAGCCATTAAATTGGGCAACTTAATTGCTGCAGAAAATAGAGCTCTATATCAAGTGTTCAACAGAAGTAAGCTGATGGAGATTTTGGAGAGGATCAAGGAGTCATCTCTGTTCCTTATGGAAAAAGGAACAGACATTTTAGGTTTTGAAATAAGGGAATAA
Protein
MDNTLQLHSTQYTPLRNKRSRHLLQREETLNVSPILNDTSIFKNLNDSSLRHVLDESSILANPSSTGDHLSEEFFEIIQSSRPSSVLDTLARLAQVCCDSLELIEPWNRYNVHNYWLAEEANTWKLIHCLYADSISEHPESLENLVTEATLSQQSLVNALFRSDSELRLLQLLVDWLEATAAYQEEATKTSAPVIGNNIHWGNTLHELLIGNSLFNKEKNKSLVTCMDPDAPRRQNKSIHSDDMKDDSDLCKRIFTEVRCGKFQEAVSLCISAGQAWRGAVLQGWKLLHYLPKDDPTDPLEIQGNPSRDLWKWCALGIANCASENIYYRATIGILSGHLPSALLACQGSWEDILWAHLKIQIEVRVDKFLHEHHLTVDANTTPSDVLDLLQAEFQTDEISLQQVFSAVKSLMDGKRESNYQLCQRYLMLGQVRTIMLNSLEWLENANERFIRFLAHLILVLRQMGKDPQHDVGDQVLEKYVTLLTIRLVDGSVESPELIAYYTSTVPAEKQIILYANFMDQIHKSDYRQGVVKAGLDAGIDVGASARVAIKKAIADIQQGYGNVELNFTQTSVIEKDKTLISKVISSLEWLALVDNQLEEALWLNNAMIRTFIFIGNTDAANACLTSFNKMFSNFINTVDSSTSELREHLCLKAYLDALEGFATWYRHFISGQPKDVQPLPPDATFSDKVYHEQQCAQVEKKKAIWINAVSHQSRHTKSLLYNVLLFPGGWLQDESDSTSSDNFNQEEKTERLKQLDTLRRLCVPEIVILLLKILQSNEDIESHKEAIKLGNLIAAENRALYQVFNRSKLMEILERIKESSLFLMEKGTDILGFEIRE

Summary

Description
Functions as a component of the nuclear pore complex (NPC).
Plays a role in nuclear pore complex (NPC) assembly and maintenance (PubMed:20547758). Required for nuclear import of Mad (PubMed:20547758). Plays a role in double strand break repair by relocalizing the heterochromatic double strain breaks (DSBs) to the nuclear periphery as part of the homologous recombination (HR) repair process (PubMed:26502056). Regulates cytokinesis during spermatocyte meiosis by maintaining type-B lamin Lam localization to the spindle envelope (PubMed:27402967). Regulates female gonad development and oogenesis (PubMed:26485283).
Subunit
Part of the nuclear pore complex (NPC).
Similarity
Belongs to the nucleoporin Nup84/Nup107 family.
Keywords
Chromosome   Complete proteome   Cytoplasm   Cytoskeleton   DNA damage   DNA repair   Membrane   mRNA transport   Nuclear pore complex   Nucleus   Protein transport   Reference proteome   Translocation   Transport  
Feature
chain  Nuclear pore complex protein Nup107
EMBL
BABH01033319    KZ149909    PZC78199.1    NWSH01002102    PCG69190.1    ODYU01011769    + More
SOQ57703.1    JTDY01001053    KOB75003.1    RSAL01000002    RVE55007.1    RVE55060.1    GAIX01014112    JAA78448.1    AGBW02011467    OWR46602.1    KQ461153    KPJ08644.1    KQ459595    KPI95863.1    AAZX01009429    NNAY01003398    OXU19478.1    KZ288203    PBC33359.1    KQ759879    OAD62237.1    GL447255    EFN86724.1    GBYB01003413    GBYB01005209    JAG73180.1    JAG74976.1    NEVH01009382    PNF33216.1    KK107545    QOIP01000010    EZA49072.1    RLU18091.1    KQ981200    KYN45051.1    KQ982691    KYQ52023.1    KQ980943    KYN11260.1    KK852714    KDR17897.1    KQ977141    KYN05331.1    KQ414617    KOC68273.1    ADTU01005685    GL438828    EFN68186.1    KQ976667    KYM78269.1    GL767018    EFZ14395.1    GL888862    EGI57538.1    CVRI01000070    CRL07254.1    DS231869    EDS40878.1    GFDL01015472    JAV19573.1    GAMC01006368    JAC00188.1    AXCN02000252    GECU01000871    JAT06836.1    GGMS01007646    MBY76849.1    AAAB01008987    EAU75643.3    LBMM01001513    KMQ96166.1    APCN01000909    AXCM01000138    JXUM01155894    KQ572328    KXJ68046.1    CH477285    EAT44760.1    GAKP01022687    JAC36265.1    GFXV01007805    MBW19610.1    GDHF01012131    JAI40183.1    GBXI01014238    JAD00054.1    AHAT01008861    GEZM01033229    JAV84333.1    ADMH02001124    ETN64043.1    DS235035    EEB10806.1    BX897665    ATLV01017297    KE525161    KFB42084.1    ABLF02022012    KQ971372    EFA09537.1    EF057986    ABL84921.1    EF057984    EF057987    ABL84919.1    ABL84922.1    AE014134    AF160938    AAD46878.1    EF057988    ABL84923.1    EF057981    ABL84916.1    EF057983    ABL84918.1    EF057985    ABL84920.1    BC125812    AAI25813.1    EF057980    ABL84915.1    EF057977    ABL84912.1    BC133201    CM004471    AAI33202.1    OCT87487.1    EF057992    ABL84927.1    JT406389    AHH37571.1    EF057989    ABL84924.1    EF057994    ABL84929.1    EF057991    ABL84926.1    EF057995    EF057997    EF057998    CM000361    CM002910    ABL84930.1    ABL84932.1    ABL84933.1    EDX04596.1    KMY89612.1   
Pfam
PF04121   Nup84_Nup100        + More
PF01395   PBP_GOBP
PF05018   DUF667
Interpro
IPR007252   Nup84/Nup107        + More
IPR006170   PBP/GOBP       
IPR036728   PBP_GOBP_sf       
IPR007714   CFA20_dom       
SUPFAM
SSF47565   SSF47565       
Gene 3D
PDB
5A9Q     E-value=2.03693e-89,     Score=842

Ontologies

Topology

Subcellular location
Nucleus  
Nuclear pore complex  
Nucleus membrane  
Nucleus envelope   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Cytoplasm   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Cytoskeleton   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Spindle   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Chromosome   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Nucleus matrix   Located on both the cytoplasmic and nuclear sides of the NPC core structure (By similarity). During syncytial embryo and larval neuroblast mitosis localizes to the nuclear envelope in interphase, accumulates in the nucleus in prometaphase, localizes to the spindle envelope in metaphase and then to condensing chromatin in telophase (PubMed:18562695). In spermatocytes, detected in the nuclear matrix by the nuclear envelope in metaphase I, and in the spindle envelope in premeiotic nuclei and during anaphase I (PubMed:27402967). Colocalizes with type-B lamin Lam throughout meiosis I (PubMed:27402967). Unlike in mammals, does not localize to kinetochore (PubMed:18562695, PubMed:27402967).   With evidence from 1 publications.
Length:
838
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00776999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  838
 
 

Population Genetic Test Statistics

Pi
209.99186
Theta
223.092634
Tajima's D
-0.344145
CLR
7.58345
CSRT
0.28133593320334
Interpretation
Uncertain
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号