SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13595
Pre Gene Modal
BGIBMGA012804
Annotation
PREDICTED:_nucleic-acid-binding_protein_from_mobile_element_jockey-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.504
 

Sequence

CDS
ATGAAGTTAAACCCCTTAAAAAACCCTCAACCACAACACAAACAGCTTACTCAACAAGCACTCCTTCCAGGCTTGTTTGACAGACAACGTTCGTCATCTCTTTCTGACCTGGGAAGGTCACCACAAGACACGACCAATGTAGAGCAACCAAATGTAGCCAGTATCGCACCAGTAGCAACCTTGCTGGAAGATATTCCTCAACCCCCTGCTCCTCCACCATGGCAAAGGGTACAATCACCCAATAGCAGAAGCAGTAAGAAAAGAAAGTACTCCAGTTCCTCACCAGAGGCCCCAAGTACCACCGTGAAAAACCGCTTCAGCACCTTACCTTTAGACGCAACGGATGAACCATGTACTACCGACCGCCCTAAACCCAGCAAACCTCCACCTATAGTCCTCAATGGTATAGAAGATGTTACAGAGCTATCGAAGCTCCTTCAAACCGTCAGCAGCAAAGATGATTTCAAATTTAAACTAATTAATAAAAACCTACTCCATATTCTGGTTAACAATGCTGAGGAGTATAAGAAAATCATAGCGGTAATAAGAGCAAATGGACTCATAGGACACACATTCACCCCTAAAGACATCAAATGCTATCGCATTGTCATAAAAGACCTCCACCACAGCACACCCCATGAAGCGATAACAGAAGCCATTGAGGCAACTAACAATAAAATTAAAGGCGAAATCATCAATGCACGTTACGGACCCGACAAGAAACCTACATCTACTTTCTTTGTAAACATTGAGCCTAGTGTAAATAACCCTGCAGCCAAGAATATAACTCATATATTTAACCAAAAGGTCAAGATAGAGGATCCTCGCAAATCAAAAAGTATTGTTCAATGTCAACGTTGTCAGCGCTACGGTCACTCGAAAAATAACTGTATGAGACCATATAGGTGCGTTAAATGCGGTGAGGGTCACAAAACCTCGGAGTGCCAAAAGAAAGATAGAACCACACCAGCTAAATGCGCTCTCTGCTTGTGTGATCACCCGGCTAACTACAAAGGCTGCGAAATTTACAAGGAAATCCTTGCCCGAAGAAACAAAAACTTTACTCCAAGAGAAAGACAACCCGCTCTAGCTATCACAGCCTTGCCCATTAATCCAATCAGCTCCATATCGACAAAAACTGAAGGTATCGAAAGACCAACTCACCAACGAACTTATGCTGAAGTCGCTGATGGAAGGAATTCCCAATCTAATCAACAATCCTACAACAAACTGGAAAACATCCTACTTAAACAAAGTGAGAAAATGGACCTCCTATTACAACAAATAGGCTCCTTAGTGAGTCTTATTACTTCTCTCGTCTCCAAGCTTCTAAAATGA
Protein
MKLNPLKNPQPQHKQLTQQALLPGLFDRQRSSSLSDLGRSPQDTTNVEQPNVASIAPVATLLEDIPQPPAPPPWQRVQSPNSRSSKKRKYSSSSPEAPSTTVKNRFSTLPLDATDEPCTTDRPKPSKPPPIVLNGIEDVTELSKLLQTVSSKDDFKFKLINKNLLHILVNNAEEYKKIIAVIRANGLIGHTFTPKDIKCYRIVIKDLHHSTPHEAITEAIEATNNKIKGEIINARYGPDKKPTSTFFVNIEPSVNNPAAKNITHIFNQKVKIEDPRKSKSIVQCQRCQRYGHSKNNCMRPYRCVKCGEGHKTSECQKKDRTTPAKCALCLCDHPANYKGCEIYKEILARRNKNFTPRERQPALAITALPINPISSISTKTEGIERPTHQRTYAEVADGRNSQSNQQSYNKLENILLKQSEKMDLLLQQIGSLVSLITSLVSKLLK

Summary

Pfam
PF07530   PRE_C2HC        + More
PF02036   SCP2
PF00628   PHD
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR006579   Pre_C2HC_dom        + More
IPR036527   SCP2_sterol-bd_dom_sf       
IPR039543   POX18/YhbT/NSL-TP1       
IPR003033   SCP2_sterol-bd_dom       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR001965   Znf_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR019787   Znf_PHD-finger       
IPR000477   RT_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR035979   RBD_domain_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF55718   SSF55718        + More
SSF57903   SSF57903       
SSF56219   SSF56219       
SSF54928   SSF54928       
SSF57756   SSF57756       
Gene 3D
PDB
5I1R     E-value=0.0134258,     Score=91

Ontologies

Topology

Length:
445
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.90163
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00364
outside
1  -  445
 
 

Population Genetic Test Statistics

Pi
165.782767
Theta
147.644333
Tajima's D
0.491814
CLR
0
CSRT
0.515274236288186
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号