SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13582
Pre Gene Modal
BGIBMGA005007
Annotation
PREDICTED:_uncharacterized_protein_LOC101737582?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.834
 

Sequence

CDS
ATGGGGAACGGGGGCTTCTGCCTTTACTGGTCGAAGCCGCGAGGATGCAAACCTCTTCAAAAATGCCCTAATCCCAAGCTCGACACCCGGCGATGGGATGATGAAGGGGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGTGTTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTATAATCAGTCCCACCAAACCATCGGCGGGGAAAAAGAGGGGGAGAAGAAAGACGGCATTACCAATTTCCGATGACAGCTGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTCCGGGGCCTGCTACGTCGGAAGACGCGATGCCCGCTCCCCAGTGGGTACCAGTGAGGAGGAGGGGCGCTGTGTCACCAGCGACGTCCGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCACTGGTCAATTTGGGCAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAACGGCTCCGGGAGGCAGCCGCTATGAGAGAGTCGCATCTCGGGAGATACCCCGGCCTTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCGCCGCTGGCACGCTCTGGCCCCCCCGCGGGGCGATGGATATTGACGTGCACTTGCGGTCCGCTGTGAGTGTGACGGCGCAAATGCCAGAGCCCAATCCTGTGGCCCCTGTCCCGCTAGCGCCTAGCCCCGCGCTCCCTCGCCCTCCACGTAGGGTCGAGTTAAGGCCTGCGCCGCCTCCGCGGATATCGGCTGCCCCTGCGTCTACACGGAGAGGAAGGCTAAGCCCTGCGCCAGCGCGGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCGGCGCTACCGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTTGCAGGCTCGCGGGCCACACAACACGGCTGCTGGGATGGTAGAGGTGGACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGTATCTCGCGGGCGGTGGCGCTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGTTCCTCGATTGGTTCCGGAGACTGCATCCCGGCGCCAACAGCCGCAGCCACCCCTCGGAGCCAGGCCGCCCGGCCGACCTCTATCCCCACTCCATCCGCGAGGTTGGCACGGCGTAGAGGCCGGGACCAAAACAACAAGGATACGGGTGCCCAGAATCCTGTCCCAAAATCCCAACCCCGTCCCCTTCCTGCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGCAAGGCAGCAGACAGCGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCCGACCGCTGCAGCACGAAGCACAGAGCTGGCGGCCGTAGCTGCTCCTCGTGAGAATCGAGCACTGGCAGCCAGGAAGAAGAATGGCAAAAAGAAGAGGCCGCGCGCAGCGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCGGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGCGCGGCCGTAAGTTTGGATGAAATCGGGGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCCGACAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCACTGCCGGAGGATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGAATCACCGGCCTGGACGACTGTGCTACCAAGGAGGAGGTGGCAGCCGCGATAGCCGCCCAAGGTGGATGTGCCCTGGAGAGCATGACCGTGGGCGAACTTCGCTCAGGGTACTCTGGAGCCAGGTCGGTGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCGCCGGGAAGATCGACGGGGGACCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGTCTCCGATGTTTTAGCACCGGGCACGGCCTCGCTAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGTACAGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGCCGAAAATCAAAGCGCCGACAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGATGCGGCGCCGGTGCCGGAGGGCGGGGCAGCGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCTGGCGATGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGCGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCGGGGTGGTTTCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTAGACTCCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGAGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATGGGGGGGCGCTGGAACGGCACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTTATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGTCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGCTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGCGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGATCCTTCGGGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCCAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MGNGGFCLYWSKPRGCKPLQKCPNPKLDTRRWDDEGGCATGSGIPVEPRCSPIAGSMRSALASDSGIISPTKPSAGKKRGRRKTALPISDDSCASSSGTEVPEKTMAIEEVTPVVPGPATSEDAMPAPQWVPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMRESHLGRYPGLAGRDSPVAEAAAGTLWPPRGAMDIDVHLRSAVSVTAQMPEPNPVAPVPLAPSPALPRPPRRVELRPAPPPRISAAPASTRRGRLSPAPARAEDIRSPLARMVDEWPALPPPLSPSRAAGLQARGPHNTAAGMVEVDSLPSREEMVACISRAVALEVGKHFAGLEEMLRSSIGSGDCIPAPTAAATPRSQAARPTSIPTPSARLARRRGRDQNNKDTGAQNPVPKSQPRPLPAPPSSMDEGWTEVVKRGKKARQQTAALAAPRGGRAPTAAARSTELAAVAAPRENRALAARKKNGKKKRPRAARSAAVVVTLLPAAAEKGLTYNEVMARARAAVSLDEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEDEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESMTVGELRSGYSGARSVWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGDNTERNRRRKSKRRQKRRLARGALANAVIPDAAPVPEGGAADMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPWRCDSRGGPQCEVCRMGLPRSDARGRLLERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALLVLLRKEGRPADTAAGYRPIVLLDEVSKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVMGGRWNGTECPPTFAGWWVPTWRTDRSRVPDTVGSCTGSRSCAVFHRGRCSAPFCGISGMTGRHVGRGPGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWALEAEALAADYQWRADLRARGVARPSHSVVRARRAQSRRSVLESWSRRLADPSGRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1683
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.08247
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1683
 
 

Population Genetic Test Statistics

Pi
171.568499
Theta
142.785605
Tajima's D
0
CLR
124.742188
CSRT
0.373481325933703
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号