SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13574
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.157
 

Sequence

CDS
ATGAGTGACACCAACGCTGTGCTATTCATGAAGTTCGTCCGCGACGTCTGTCCGGACATAATCGCAAGGTTCGAAGTTTACAAGGCCGGCCTTGACGCGCCGGCACTCCGCGACTCTCCGTTGTCGCCCCCCGCGCCGGTACCTCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCTGCGTCGATCGCGTCTTGCGCGGCATCAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAATCGTCCGCGGCGCCAAAACAACCTAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGACCCCAACCCGCGTCCGTCCGCAAAATTCCCGCGCCGCCGCCGGTAATTTTACAAGATAAGACCGCGTGGGATCGCGTATCCCGTGCCTGTAAGGCACAAAACGTCACCGTTATCCATGCGCGTAACATCGCGCACGGCATACAGATAAAAACGGCCTCACCGGACGACCACAGGGCGCTGACAGCCCACCTCCGAAAGGAACGCATAAGCTTCCACACTTATGCGCTCCAGGAGGATCGCGAGCTCCGCGTAGTAATACGCGGAGTACCGAAGGAGCTCGACGTCGAGCTGGTCAAGGAGGACCTCATCGGGCAGGCGTACCCGATTGTAAGCGTGCACCGAATGCACAGCGGGCGCGATAAATTCGCATATAATATGGTTCTCGTCGCGTTAGAACCAACCGCCGAAGGCAAACGGATTGCCTCAAGCCTCCGCACCGTTTGCGGCTTATCCGGGGTCACCGTCGAGGCCCCATATAGAAAAGGCACTCCCGGGCAGTGCCACCGCTGCCAGCTTTACGGCCACTCCGCGCGCAACTGCCACGCGCGTCCGCGGTGCGTAAAGTGCCTCGGTGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACCGCGACCGAACCTCCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCTCCAAAAACCGTCGGCCCAAAGACTTCGGCGCCCCGTGCGCCGAAGCCTGCCTTCGTGCCGGCACCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGCTGCCGCTCACGCTGGCAGGGAAACCACCGGCACCCCAGCCCCTGCTCGCGCCGCGCCCCGCCCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCCCGGCCAGCCGTTAACGACTTTTCAATCGTGCGTGATTATATCGCCGCGATAAATATAGATCGCATGCGCTCGTTCGCCGACGCCATGCGCAGGGCGGTCACGGCCGATGACCGCCTATACGCGACGTTCGACCATATGGACGTCATCGAGTCCCGCGATCAAGTATATGAGTTTCTCCGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCCGACCCCCACGTACTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGACAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCGAGGATACCACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGGAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGCTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCCGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCTTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MSDTNAVLFMKFVRDVCPDIIARFEVYKAGLDAPALRDSPLSPPAPVPRDSPMSPPTPAPASIASCAASSSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVESSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPQPASVRKIPAPPPVILQDKTAWDRVSRACKAQNVTVIHARNIAHGIQIKTASPDDHRALTAHLRKERISFHTYALQEDRELRVVIRGVPKELDVELVKEDLIGQAYPIVSVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPYRKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPPKTVGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPLTLAGKPPAPQPLLAPRPAPAPGPAPRPGPARPAVNDFSIVRDYIAAINIDRMRSFADAMRRAVTADDRLYATFDHMDVIESRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTYYPYNAARRPSTIDLALLRNVTLRLRSIETMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPRIPLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEEFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTPSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0036575,     Score=101

Ontologies

GO

Topology

Length:
1401
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.62314
Exp number, first 60 AAs:
0.00023
Total prob of N-in:
0.00002
outside
1  -  1401
 
 

Population Genetic Test Statistics

Pi
11.716977
Theta
104.256271
Tajima's D
0.437887
CLR
0.326412
CSRT
0.499625018749063
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号