SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13564
Annotation
PREDICTED:_uncharacterized_protein_LOC106136784_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.256
 

Sequence

CDS
ATGCCGATCACCAGGAGCAACAAGGGATCATCGAGGGAACAGCCACTCGAACCTGCGGTTCAAGAATCCAGTCCGGAGGCAACAGAAGCGTACGAAACATACGAGAGCTCCGCGACCGGTACGACCCAGAACACAAAACTTGAAGAGGCAACGACGCGGACACGTGGTAAAAATAGACCCGCGTCGAAGAAATCGCTACGACGTAAGGAACTGGCAGCGAGAGCGGAGCTGGCGGAAAAAGAATTGATAGAAGCACAAGCAGCCACCATAGCCGCCAGACTCCGCCTGCAATTGATTCAGGCCGAAAGCGAAGACGACGATGATTCCATTATAGAAGAGCCAAAGGACCGGGAGGACCAGGTCAGGGCCTGGGTCCAGACGTCGGCGGGCAGTATGGACAAGGAGCCCGCAGGCGAGCACATTGAGAACCACCCCGTCAGCAAGGCCAACATGGAAGATTGCAGCAACAGGGACCTGGCTGAGGCGATAGTGGAAGCGGTGAGGAGCGCAACGACCAAGGAGCTGCCACCACAACCCGACTACATGCACCAGTTGCCGACGTTCGAAGGCGACTGCAGGGAGTGGGTGGCCTTCAAGGCTGTCTACGAGGATACCGCTCCACTCTTCTCAAGCGCTCAAAACATGGCGCGGCTGAGAAGAGCGCTGAAAGGACAAGCCAGGGAAGGAGTTCGCAGCCAGCTGTACTCCGAGAGCACACCGGAGGAAGTAATGGAATCACTGCGGCGGTGCTATGGAAGGGCGGACGCTTTAGTCTTAGCGGAGCTAGACCGCATACGAAGACTTCCGACTATAAGCGACTCCGCCTACGACATTTGCTCACTGGCGAGCAATGTTAACAATACCGTCGCAGCGATCAGGGGGCTGCGGAAACCCCAATATTTGATGTCGCCCGAACTCCTGAAGAGCATCGTCGACAAGATGCCGACCATCCTGAGGTTCCGGTGGTACGATCACATTATCGAAAAGACTGAAGGAGACCCGGACCTCAACACGATGTGCGGCTTCCTAAACAAGATGGCGGACCGGTGCGGGCCACACGCCGTGGCTGAAGTAGCAACGAAAAGACAACCATCGAGGCGACAGGCGACGCACGCCACAACCGACTGCACCGAGCGCGCAACTTCGGACAGAGTAATAATAGACAAGCCGGCGTGCCCGCAGTGCAATGAAGGGCACCCACTGTACGATTGTCCGAGGTACGAGAGAGCTACGGTGCAGGAACGATGGAGAATGGCAAAGGAGTCGCGCCTGTGTTACAAGTGCCTCGACGGTAAGCACCGGAAGCAATCATGTCAACGACCGCCATGCCGCACGTGCAAGCGCTGGCATCACCACTCGCTACACAACGAGAAGCCGGAGACAGAGCCAGCAGAGAACAGGGAAGTCGCGAACAACGTGCGACTTCCCATCAACTGCACACGGATCAGCAGGGCGTACTTGAAGATGGTGCCCGTTGAAGTGTACGGGCCGTCGGGATCGACGACGGTGCTGGCCCTGCTGGACGAAGGCTCCACGGTAACTCTCCTGGACTCGAGCGTGGCGAAGCAGATCGGCCTGAAGGGACCCAAAGAGATGCTCCGCCTCGAGACCGTGGGCGGGAAGACCCTAGCGAAGAAGGACTCGATGAAGCTTAACATCCGAGTTCGAGGGCTTCACCAGCGGCAGAAGAGGACGATCTTCGGAGCGCGCACAATGGACGACATGAGCCTTGCACCCCAGCGATTGAAAAGAGAGACCATCGAAGGCTACGCGCACCTGAGGAGCCTAGCGGACCAGTTAAATTACGAAGAACAATCCCCCAAACTATTGATTGGGCAGGACAACTGGGGACTCATCGCCGCCAAGACGACGCGCAGGGGCAAGAGGAACCAGCCGGTAGCCTCATTCACCCAATTGGGATGGGTGCTACATGGTCTCGACGGCAACAACGCAAAAGAGGTCAACTTCCTCACCTGCGCCCATGTATCGATGCGCGAAGAGGCCTTGGACAGACTGGTGAAGGAGCACATCGCAATAGAGTCGCACCCAAGCGTCCGAGCACGGATATGGAGGCGAAGGCTCGTCGCGGTTGTCGCGGACATCAAGGAGAGGTTCCTGCAGATAAGGATCAGGGACGAGGACCGCGACAGCCTGAGATTCCTCTATAGAGAAGATCGACGCGAGGCCGCTTCAAAAGAGTATAGAATGACGTCGGTCATATTCGGAGCGGCCTTTTCAACGAGCGCGGCGCTGTTCGTTACAAATAAGAATGCCAAGGAGTACAAACATCGTGCTAATAGAAGGGAAAGCGCTCATTCAGAGCATTTGGCGGAGCGAGATCGACTGGGACGACGTCATCCTGGAAAAGGACGAGGTGGCGTGGAAACGCTACATGGAGAACCTCCGCACGTTGCAAGGCCTCCGATAGCAAGGTGCTTCTCGTGCTGCAACACTGAGGGGGAGCTGCACACGTTCACCGACGCCAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAGGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAGAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGTTGCACTGCTGGGGACAAGGATGGCACAGGCGATAGCGGACGAATTGGACATCGCGGTCGGTGGAAGGACGTACTGGTCTGACTCCAGCACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAGAACCCAGCGGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGTCGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACCTTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTACCTGGTCGCTACAGCGAGGACCGCTGACGCTCAACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAGGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATCGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTACAGAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGGTGCGGCAGCGCTACTGGATCCTGGGTCTAAGATCGACCATTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGACTACCGCCCACCGGAGACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCCATGACGGTGACTGTAGGACGACGTCACGAGAAGAGGTGGGGTGTGCTGTTCACATGCCTCACCACGAGAGCAGTCCACATGGAGCTAGCAGCGTCACTGACGGCAGACTCAATGCTGTTAGCGCTGCGCAGGATGGCCGCCCGACGAGGAATGCCCAAAGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCTAACAAGGAGCTCAAGCAGGCGATCGAGAACGCGAGGGAAACAGACGTCATGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGTGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAACCACTTCCTCATAGGGAGGTCTTGCGGAGCTCCGCGAATCGGCGACTACACAGAAGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCGGACCACTTCTGGAGTAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGATGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MPITRSNKGSSREQPLEPAVQESSPEATEAYETYESSATGTTQNTKLEEATTRTRGKNRPASKKSLRRKELAARAELAEKELIEAQAATIAARLRLQLIQAESEDDDDSIIEEPKDREDQVRAWVQTSAGSMDKEPAGEHIENHPVSKANMEDCSNRDLAEAIVEAVRSATTKELPPQPDYMHQLPTFEGDCREWVAFKAVYEDTAPLFSSAQNMARLRRALKGQAREGVRSQLYSESTPEEVMESLRRCYGRADALVLAELDRIRRLPTISDSAYDICSLASNVNNTVAAIRGLRKPQYLMSPELLKSIVDKMPTILRFRWYDHIIEKTEGDPDLNTMCGFLNKMADRCGPHAVAEVATKRQPSRRQATHATTDCTERATSDRVIIDKPACPQCNEGHPLYDCPRYERATVQERWRMAKESRLCYKCLDGKHRKQSCQRPPCRTCKRWHHHSLHNEKPETEPAENREVANNVRLPINCTRISRAYLKMVPVEVYGPSGSTTVLALLDEGSTVTLLDSSVAKQIGLKGPKEMLRLETVGGKTLAKKDSMKLNIRVRGLHQRQKRTIFGARTMDDMSLAPQRLKRETIEGYAHLRSLADQLNYEEQSPKLLIGQDNWGLIAAKTTRRGKRNQPVASFTQLGWVLHGLDGNNAKEVNFLTCAHVSMREEALDRLVKEHIAIESHPSVRARIWRRRLVAVVADIKERFLQIRIRDEDRDSLRFLYREDRREAASKEYRMTSVIFGAAFSTSAALFVTNKNAKEYKHRANRRESAHSEHLAERDRLGRRHPGKGRGGVETLHGEPPHVARPPIARCFSCCNTEGELHTFTDASEKAYACAVYWRQRTDESTYRVTLLAGRARVTPLRPVSIPRLELQVALLGTRMAQAIADELDIAVGGRTYWSDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLSWDESRWPKPRTFKQEPSGEEKEAYLVATARTADAQPTPDPHRFSSWVRLLRATARVLQFIELCRPRKESACVSRQSKQQDPTWRTTRTKQPRSTWKLRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEVRQRYWILGLRSTIRATAVRCQWCKVYRSTPRLPPTGDLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRWGVLFTCLTTRAVHMELAASLTADSMLLALRRMAARRGMPKVIYSDNGTNFVGANKELKQAIENARETDVMSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALVVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPRIGDYTEEDLTGKRTWRVAQRMADHFWSRTSGGLLKRPASKMILLMPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1490
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03351
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  1490
 
 

Population Genetic Test Statistics

Pi
410.145068
Theta
192.505905
Tajima's D
3.194621
CLR
0.449564
CSRT
0.986250687465627
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号