SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13547
Pre Gene Modal
BGIBMGA009030
Annotation
PREDICTED:_uncharacterized_protein_LOC105842396_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.516 Mitochondrial   Reliability : 1.947
 

Sequence

CDS
ATGGCAAAATGTGGAGCATGTGGAAAATTCTTGTCAACCGCGGACTGTGCGCGTTGTAGTAAATGCAGTGACAATTTCCATAAAGGATGCGTGGCAATCCCATCTACGGGCGCTGCGCCTCGGGGCTGGATCTGCCCTAGTTGCTCAGCGAAGGTACCTCGTGGGGATAATGCGGCAACTCCTGTACGAGGGTTGACAGCTGTCGGGGTGCATCACACTTCGAGCGAGGGAGATGTTGATGCAGATACGATGAATCGGTCGCTGGAGTCTCGTGTCGACCTTGGCTTAGAAATCCGATCTTTTAAGGATGAGCTGGTGGGCCTAAGAACTGACTTGAGAGAGTGCCGAAATGATATCGCTGAGTTTAAGGAGCTCCTCAAGTCTTGTCATGGACGCATCGACGCGGTGGAAGCCCGAGTGCTTGGTCTTGAGGCTCGTCTAGCAGAGATCGTCTCAACAGCAGCAGGTTCTGACTTGGATTCCACGGTGGCTGAACTTCGCATTCAGCTGCGTGAACGCGACCAGGACTTGCTCAGGAATGATATTGACATCATTGGTTTGCCGGAAGTTCGTGAAGAAAGCACTTGTCATTTAGTCCAGGTTGTGGCGGTAAAACTGGGAGTGAAACTTGACGTGCGCGACATAGTTCACGCGGAGCGGATTGGTGCAGTAAGACGCAATTTCATTGAGGGCAACGACAATCGTCCTCGTATACTATCAGTACGACTGGCCCGTCGCTCGGTTCGCGATGCACTATTGAAGGGAGCCCGCGTGCGCCGTAACCTCTCCACTACTGATTTAGATGTACCTGGCCCCGTCCGTACTGTATATTTAAATGAACGTTTGTCCGCATATAATCGCAAGCTGTTTGGTACTACCCGTCAAAAGGGAAAGGATAAAGGTTGGAAGTATGTCTGGACCAAGGACGGACGAATTTATATTCGTCGTGGTGATGGTACTCCTGCGCTCAGAATCAGAGTTCAGGCCGACGTGGAGAAGCATTTTGGCCCGGATACAGTTTGA
Protein
MAKCGACGKFLSTADCARCSKCSDNFHKGCVAIPSTGAAPRGWICPSCSAKVPRGDNAATPVRGLTAVGVHHTSSEGDVDADTMNRSLESRVDLGLEIRSFKDELVGLRTDLRECRNDIAEFKELLKSCHGRIDAVEARVLGLEARLAEIVSTAAGSDLDSTVAELRIQLRERDQDLLRNDIDIIGLPEVREESTCHLVQVVAVKLGVKLDVRDIVHAERIGAVRRNFIEGNDNRPRILSVRLARRSVRDALLKGARVRRNLSTTDLDVPGPVRTVYLNERLSAYNRKLFGTTRQKGKDKGWKYVWTKDGRIYIRRGDGTPALRIRVQADVEKHFGPDTV

Summary

EMBL
BABH01012931    BABH01012932    ODYU01011375    SOQ57082.1    NWSH01000010    PCG80924.1    + More
LADJ01030744    KPJ21224.1    KQ461191    KPJ07137.1    JTDY01001653    KOB73242.1    ODYU01010286    SOQ55282.1    NWSH01001817    PCG70031.1    NWSH01001982    PCG69514.1    JTDY01000042    KOB79218.1    JTDY01017010    KOB51869.1    KZ149908    PZC78213.1    NWSH01008646    PCG62462.1    JTDY01009085    KOB64118.1    ODYU01004417    SOQ44266.1    KZ150150    PZC72841.1    JTDY01000562    KOB76673.1    ODYU01010507    SOQ55661.1    NWSH01001505    PCG71029.1    ODYU01008890    SOQ52873.1    JTDY01002313    KOB71687.1    NWSH01000125    PCG79301.1    NWSH01003975    PCG65605.1    JTDY01007941    KOB64843.1    NWSH01005158    PCG64392.1    NWSH01002711    PCG67639.1    JTDY01000739    KOB76046.1    JTDY01003157    KOB70048.1    JTDY01002139    KOB72021.1    NWSH01002730    PCG67615.1    JTDY01014864    KOB51988.1    JTDY01005149    KOB67319.1    JTDY01006205    KOB66199.1    NWSH01002492    PCG68176.1    JTDY01002895    KOB70525.1    JTDY01017442    KOB51849.1    JTDY01000181    KOB78416.1    JTDY01006445    KOB66006.1    JTDY01000729    KOB76082.1    JTDY01000624    KOB76430.1    JTDY01007036    KOB65506.1    JTDY01003432    KOB69564.1    KZ150197    PZC72320.1    JTDY01000273    KOB77970.1    GDQN01006224    JAT84830.1    JTDY01000032    KOB79297.1    JTDY01006255    KOB66167.1    GDQN01009099    JAT81955.1    JTDY01000945    KOB75331.1    JTDY01009571    KOB63316.1    JTDY01009015    KOB64201.1    GDQN01007706    JAT83348.1    GDQN01000556    JAT90498.1    ACPB03011237    ODYU01007238    SOQ49844.1    ACPB03024613    ACPB03027065    ACPB03014935    KOB70049.1    NWSH01000826    PCG73989.1    ACPB03021827    RSAL01000024    RVE52218.1    ACPB03014947    RSAL01001410    RVE40802.1    RSAL01000033    RVE51438.1    ODYU01007128    SOQ49629.1    BABH01014938    NWSH01007563    PCG62908.1    JTDY01015045    KOB51976.1    JTDY01001455    KOB73826.1    JTDY01007401    KOB65231.1    JTDY01010989    KOB57787.1    KQ460397    KPJ15249.1    KQ459054    KPJ03878.1    JTDY01004632    KOB67925.1    JTDY01008292    KOB64643.1    NWSH01005418    PCG64228.1    JTDY01009133    KOB64064.1    GBRD01009465    JAG56359.1    KZ149914    PZC78000.1    GBHO01013672    JAG29932.1    GBHO01033077    JAG10527.1    NWSH01002191    PCG68944.1   
Pfam
PF03258   Baculo_FP        + More
PF00628   PHD
PF00076   RRM_1
Interpro
IPR019787   Znf_PHD-finger        + More
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR011011   Znf_FYVE_PHD       
IPR019786   Zinc_finger_PHD-type_CS       
IPR004941   Baculo_FP       
IPR004244   Transposase_22       
IPR001841   Znf_RING       
IPR002219   PE/DAG-bd       
IPR027267   AH/BAR_dom_sf       
IPR036427   Bromodomain-like_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR035979   RBD_domain_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR034209   PUF60_RRM1       
IPR018527   Rubredoxin_Fe_BS       
IPR036236   Znf_C2H2_sf       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57903   SSF57903        + More
SSF103657   SSF103657       
SSF56219   SSF56219       
SSF54928   SSF54928       
SSF57667   SSF57667       
PDB
5VAB     E-value=0.00859203,     Score=91

Ontologies

Topology

Length:
340
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00057
Exp number, first 60 AAs:
0.00057
Total prob of N-in:
0.02340
outside
1  -  340
 
 

Population Genetic Test Statistics

Pi
326.070854
Theta
185.780441
Tajima's D
2.135495
CLR
0.441176
CSRT
0.900154992250388
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号