SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13541
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.497
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGTGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACTGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTTGA
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDISELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDCISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCV

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GGMS01002955    MBY72158.1    GGMS01006359    MBY75562.1    KB631961    ERL87484.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GGMS01003914    MBY73117.1    GGMR01006581    MBY19200.1    GGMR01015412    MBY28031.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    ABLF02042385    KK119261    KFM75202.1    GFXV01007093    MBW18898.1    KK119069    KFM74603.1    GBYB01008290    JAG78057.1    ABLF02040174    ABLF02040183    ABLF02055266    RPOV01000134    RPJ78669.1    NNAY01003095    OXU19992.1    GBBI01001646    JAC17066.1    GBBI01004395    JAC14317.1    GFTR01008271    JAW08155.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01013409    MBY26028.1    KK115285    KFM64681.1    GFTR01008038    JAW08388.1    KK118005    KFM71947.1    S59870    AAB26437.2    GEZM01084970    JAV60359.1    NEVH01006736    PNF36716.1    ABLF02029306    ABLF02029314    ABLF02060138    GFTR01008262    JAW08164.1    KK113281    KFM59799.1    GEZM01084969    JAV60363.1    KK119375    KFM75514.1    GFXV01002840    MBW14645.1    KK114877    KFM63587.1    ABLF02041767    GGMR01018716    MBY31335.1    GGMS01000625    MBY69828.1    GGMR01002322    MBY14941.1    GGMR01019198    MBY31817.1    GBBI01003810    JAC14902.1    ABLF02016634    GGMR01000005    MBY12624.1    ABLF02028535    ABLF02028545    GGMR01012443    MBY25062.1    ABLF02015942    ABLF02015945    GGMS01002786    MBY71989.1    ABLF02017543    ABLF02017549    ABLF02017551    ABLF02021996    GGMR01000676    MBY13295.1    GFTR01008260    JAW08166.1    ABLF02065839    GFTR01008251    JAW08175.1    GEDC01029594    JAS07704.1    GGMR01011511    MBY24130.1    KB632327    ERL92508.1    GEZM01053022    JAV74219.1    GGMR01004661    MBY17280.1    GFTR01008256    JAW08170.1    GFTR01007929    JAW08497.1    GFTR01008169    JAW08257.1    GGMS01005381    MBY74584.1    KB632394    ERL94564.1    NEVH01019963    PNF22185.1    ABLF02022418    GGMR01003864    MBY16483.1    GGMR01000857    MBY13476.1    GGMR01014053    MBY26672.1    GGMR01000226    MBY12845.1    ABLF02034467    GEHC01001034    JAV46611.1    ABLF02021177    ABLF02027367    ABLF02066338    GGMS01015632    MBY84835.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
344
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.62566999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.05017
outside
1  -  344
 
 

Population Genetic Test Statistics

Pi
225.599912
Theta
44.977916
Tajima's D
3.80634
CLR
0.286827
CSRT
0.997350132493375
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号