SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13539
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.461
 

Sequence

CDS
ATGGTCCCCCCCCTGGCGATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAGTTAGAAAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGGGTTCGAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCACCTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTCGGTCTCTGTATCGTTAATAGGGGCTCGATCGCGACTTGCGTGCGGTGGACGGGCGAGTCTATCGTGGACCTGACGTTCGCGAGCTCGCCCGTCGCACGGCGCATCCTCGGCTGGAGAGTGGTGGTGGGGGCGGAATCGTTGTCCGATCACCGGTATATCCGGTACGATCTTTCTGCCCCTGCGCCGACGCCGGCTGCAGGTGCCCGCGGGGTTGACCCCCCGCAGAGTGCATCCCGGTCATTCCCTAGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTTGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCTTCGATGCCCCGGGTCGGCTCTCGGCACTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGGCGAGCCGCCGGTGCACTAGACACCGCCGTCGCCGCCGCCTGCGGCGCGACGAGCCCGTCGCGTTCGCGGAGGAGGAAGCTCGGCTGCACCGCGAATATCGCGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAGGCGGATCCGTGGGGGAGCCCATACAAATTGGTACGCGGCAAGTTGCGCCCGTGGGCCCCCTCTATGACTGAGCGTCTCCAGCCCCAGCAGCTGCGGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTTTTGTCCCTCCCGCTATGGGCGGGCCGTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACCGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAAAGACACGGCCCCCGGCCCGGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATACAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCTGGGTATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGCGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGTTTTCCGGTCGTGCGTGGTGTTCCGCAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGTCTGGGTCTCGACGTGGCGCTCAGTAAATCCGAGGCTCTGTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCCTTTCGTGCTCACTTTGCGGAGCTGGTCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTCCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MVPPLAMVTRGPGIVAVQLENIVVIGVYFSPNRPTVGFERFLDGLEVIARHLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGLCIVNRGSIATCVRWTGESIVDLTFASSPVARRILGWRVVVGAESLSDHRYIRYDLSAPAPTPAAGARGVDPPQSASRSFPRWALKLLNRELLVEASMVAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGSRHSGRRQSPWWSPEIARLRAVSIRASRRCTRHRRRRRLRRDEPVAFAEEEARLHREYRAAKDALRLAIRRAKEQNMERLLEALEADPWGSPYKLVRGKLRPWAPSMTERLQPQQLRDIVSALFPQEREGFVPPAMGGPSDTVDGQAPAEVPRITEAELRVAVVKMTAKDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVRHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLAARSVVCTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALVVGRIRSLGLDVALSKSEALWGRGAVEVPRPRVGQPVGLSCSLCGAGPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    AB078935    BAC06462.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    AB078936    BAC06464.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    RSAL01003504    RVE40273.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01012412    KMQ86235.1    LBMM01003988    KMQ92922.1    LBMM01014122    KMQ85315.1    LBMM01008278    KMQ89009.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    GGMR01015159    MBY27778.1    LBMM01004262    KMQ92649.1    LBMM01006977    KMQ90149.1    GGMR01006838    MBY19457.1    LBMM01007425    KMQ89740.1    LBMM01015285    KMQ84870.1    LBMM01002480    KMQ94776.1    ABLF02011238    GFXV01002090    MBW13895.1    LBMM01005465    KMQ91492.1    GGMR01019493    MBY32112.1    AB593325    BAK38646.1    ABLF02041886    ABLF02023257    LBMM01008445    KMQ88871.1    ABLF02034925    ABLF02011183    ABLF02041884    ABLF02004854    ABLF02041317    ABLF02018942    ABLF02041885    GGMR01012748    MBY25367.1    LBMM01015018    KMQ84954.1    LBMM01004505    KMQ92346.1    LBMM01005948    KMQ91066.1    GGMR01004600    MBY17219.1    ABLF02041557    ABLF02018808    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    AB593321    BAK38639.1    KQ971675    KYB24771.1    ABLF02009073    ABLF02030702    ABLF02042963    ABLF02014650    GGFJ01001439    MBW50580.1    KQ971309    EEZ99146.1    ABLF02007989    AB593327    BAK38648.1    LBMM01005733    KMQ91252.1    GALA01001777    JAA93075.1    KQ972691    KXZ75806.1    GGMR01000779    MBY13398.1    GGFJ01001369    MBW50510.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    KQ972544    KXZ75869.1    KU543682    AMS38369.1    GGFJ01001370    MBW50511.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GGFJ01001727    MBW50868.1    LBMM01009535    KMQ88053.1    GALA01000302    JAA94550.1    ABLF02018098    GGFJ01001453    MBW50594.1    ABLF02011927    AB593323    BAK38643.1    LBMM01008226    KMQ89040.1    GGFK01005660    MBW38981.1    GALA01001776    JAA93076.1    KXZ75807.1    GGFL01004044    MBW68222.1    KQ972226    KYB24577.1    GGFJ01001454    MBW50595.1    AB593326    BAK38647.1    GGFJ01001165    MBW50306.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=4.23686e-11,     Score=168

Ontologies

Topology

Length:
984
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.555209999999997
Exp number, first 60 AAs:
0.53012
Total prob of N-in:
0.02640
outside
1  -  984
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
153.650984
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号