SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13504
Annotation
ORF_A_span_522-1895
Location in the cell
Nuclear   Reliability : 3.296
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACACAGTATATAAGAACAGATCCTGGCAACGAATTAAATAACCTCAGCCTAATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGACCAAAGAGATGAGACCGCTTTATACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGCATTGCCACAACCATCGAGGCAAAACGCGACCTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAAATACCACCTATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAATAACCACTGGAAACCTGCTTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGAACCTGCTTACCAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAGGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAGTACCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATATCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGCTTACAACAGTTCAGTTCATAGTTTCACCAAATGTCGCCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATCGACATAACAGCCCATTTACTGCAGCAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCTCTCATTGAAAATAGAAATAAGGACCGCGAACCAGAAGCGACGTACCAACCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGCTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCCCGACTTAAACGTGCACATAAAGACTTCCGATTCCTCAAACCCAATCGTGTAAAAAGAGGTCTCATTGATGGCTTAGGTTCAATTGTTAAAAGCATTACAGGAAAGAAAATAGTTATTGTCTTTAAATTTCCTGTAATTTCTCCGGATGAATTCGAACTATATAAATTAACCATTGCCCCTAATAAGCATCAATTAACTTTCGTCCCTCCTTATCCTTTCATCGCAACAAATAAGAAAGCGTTCATGTACATAGAGGCTGAATGCCCGAAGTACAACAGGTACTACCTCTGCGAGGAAAATATAAATCACCAGCCAAGAGATGACCCTGATTGCATCCACGATCTTATCTACAATCAAGCCATGAACACTTCATGCCAGCCAACCTCTGTTTCTTTCACTAAAGAAGCCATGGAACAACTAGACGATAAGCATTACGTCCTTATTTTCCCCGAGACCACGAAGATCGAACTTCATTGTCAACGCCTGGAGTACAGTATGCTTCAAGGAAGTTATCTCGTTACCATTCCGCAAAATTGTAAGCTGCGAACCGGACGACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAAGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACCAAGCACTCTTTCATACGACAATACCTTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCGGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGGATTCCGGCAACATTTGCCCTCAAGATTATCAAATAG
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPPMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWNLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRVPINSSDGEVYIPQQYLNNCVVNECITTVVKNRAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKDREPEATYQPNQQVFIKNPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFRFLKPNRVKRGLIDGLGSIVKSITGKKIVIVFKFPVISPDEFELYKLTIAPNKHQLTFVPPYPFIATNKKAFMYIEAECPKYNRYYLCEENINHQPRDDPDCIHDLIYNQAMNTSCQPTSVSFTKEAMEQLDDKHYVLIFPETTKIELHCQRLEYSMLQGSYLVTIPQNCKLRTGRLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNQALFHTTIPFYGALCGAIVLAVVIAVHRHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
849
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.0405
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00069
outside
1  -  780
TMhelix
781  -  803
inside
804  -  849
 
 

Population Genetic Test Statistics

Pi
550.560819
Theta
246.181728
Tajima's D
3.462748
CLR
0.515616
CSRT
0.993500324983751
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号