SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13502
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.059 Nuclear   Reliability : 1.624
 

Sequence

CDS
ATGCCGCCTCTAGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGTATGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACTGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCTGCACTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAAATGTTACCAGCCCAACTGATAACGATGTTGGCCACCATCTTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCTGACGTTATCGGCATACACAAGCCGGGCAAACCGAAAAACAAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCATAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTTATAGACGAGCAGTTTGGGTTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCACCTCACGGAGCACATCTTACTAGGGCTGAATAGGCGGAAACCCATCCCGACAGGAGCCCTCTTCTTCGATATAGAGAATGCATTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACACACTCGTGCTCATCATACGAGACTACTTATCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGCCCCCGTCACGTCACAGCCGGAGTCCCGCATGGCTTCGCCCTCTCCCCGTTACTGTTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCACCGATGACACGGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGGCGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGTCCTCCGAACACCACGTTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCTCCGCCTCCACCATTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGAAGGATGACATTCCGCCCCCCTTATAAAGACGGTACGCGACCGTGCAGACTTCATTCTAGGATGTCTCTACCCGATCATATGCAGGCGAAGTAA
Protein
MPPLVRPSGQPPAYDDDDKAELLADALYEQCTTSTQYADPEHTELVDREVERRASLLHSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKMLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNKTASYRPISLLPAIGKLYERLLHKRLWDFVTANKILIDEQFGFRARHSCVHQVHHLTEHILLGLNRRKPIPTGALFFDIENAFDKVWHNGLIYKLYNMGVPDTLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPHGFALSPLLFSLYINDIPRSPETHLALFTDDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTSASTIRPITMYDQPIPWAPKVKYLGVTLDRRMTFRPPYKDGTRPCRLHSRMSLPDHMQAK

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    AF081103    AAC72921.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02003961    ABLF02059872    ABLF02029306    ABLF02029314    ABLF02060138    GALX01005359    JAB63107.1    KK117880    KFM71667.1    GGMS01008766    MBY77969.1    KQ973412    EFA12510.2    ABLF02008933    NEVH01010546    PNF32261.1    NEVH01003017    PNF40781.1    NEVH01000280    PNF43672.1    NEVH01023962    PNF17612.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01005938    PNF38077.1    NEVH01020071    PNF21969.1    NEVH01001355    PNF42855.1    GGMS01000737    MBY69940.1    NEVH01023961    PNF17613.1    ABLF02016634    KL813758    KFM83187.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01019080    PNF22876.1    ABLF02033757    GGMR01004661    MBY17280.1    NEVH01019964    PNF22161.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    NEVH01007838    PNF34986.1    KQ973073    KXZ75680.1    NEVH01006754    PNF36554.1    NEVH01005277    PNF39135.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    GFTR01008038    JAW08388.1    NEVH01026154    PNF14491.1    GGMS01017914    MBY87117.1    NEVH01011985    PNF31054.1    NEVH01019376    PNF22596.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGMS01006359    MBY75562.1    GBBI01004571    JAC14141.1    ABLF02040174    ABLF02040183    ABLF02055266    JXUM01155316    KQ572171    KXJ68070.1    ABLF02042518    ABLF02057746    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02021177    ABLF02027367    ABLF02066338    GGMR01003407    MBY16026.1    NEVH01017470    PNF24199.1    GBHO01016303    JAG27301.1    ABLF02034467    GGMR01013409    MBY26028.1    GGMR01018716    MBY31335.1    GGMR01016114    MBY28733.1    NEVH01021205    PNF19912.1    GFXV01007093    MBW18898.1    ABLF02028535    ABLF02028545    GAHY01000238    JAA77272.1    KF280391    AIE77315.1    GBBI01004395    JAC14317.1    GALX01005299    JAB63167.1    GEZM01038405    JAV81653.1    GGMR01006408    MBY19027.1    RPOV01000134    RPJ78669.1    GBYB01008290    JAG78057.1    GGMR01000676    MBY13295.1    GGMS01012005    MBY81208.1    NEVH01006736    PNF36716.1    KK115908    KFM66338.1    ABLF02023911    GGMR01012305    MBY24924.1    GFTR01007929    JAW08497.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF10551   MULE
PF03372   Exo_endo_phos
PF13358   DDE_3
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR038717   Tc1-like_DDE_dom       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
430
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.7186
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03821
outside
1  -  430
 
 

Population Genetic Test Statistics

Pi
2.440571
Theta
24.63159
Tajima's D
-1.28931
CLR
0.428154
CSRT
0.0916954152292385
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号