SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13501
Annotation
PREDICTED:_uncharacterized_protein_LOC106113211_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 1.397
 

Sequence

CDS
ATGACAATGGCCAATTGTGAAAAGTTAGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCACGCTGCTCCACGTACTCTGGGGGGGGCAACAATTGCCAGGATGAAGGAGGCTGTGCGACGGGCAGCAGAATTCCCGTCGAACCGACGCGCTCCCTGATCGCCGGCTCGATGCGCTTTGCGCTCGCCAGTGATTCGGGTGCGATCATCCCCACCAAACCATCGGCGGGGAAAAAGAGGGGCCGAAGGAAGACCCCCGTAGTAACTTCCGACGACGGCGGTGCGTCATCCTCCAGCACTGAGGTGCCGGAAAAGATCATGGCCATCGAGGACGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGACACGATGCCCGCACCCCAGCGGGCACCAGTAAGGAGGAGGGGTGCCGTGTCACCGGCGACATCGGTGGAGTCGATGTCGACGTCGGTTGCGTCTCTAGCTAGCGGGGACGAGACGTTTCGTGATCTCGACCTCGCGCTGGTCAATCTCGGTAAACTGCTGTCAACCGTGGCTGCCATGGGCGCCCAACCAGGCAGCAGCTACCGGAAAAGGCTTCGGGAGGGAGCCGCTATGGTAAGGACGAGACTGATCCCCACCATGTCCAAGCTCTATGACTTGGTGGCGAGCCGGGAGGCTGAAAACAAAGGCCTCGTCGCACAGCTTGACTCCAGGGAGAGTCGCATCCCGGGGGACTCCTCGGCCTCGCGGGGAGAGACTTCCCTGTCGCCAATGCCTACGCTGGCATGCTCTGGGCCCTCCGTGGGGACGATGGACACTAACGTGCCCTCGCAGGCTGCGATGAGTGTGGCGGCGCCTATGACAGCGCCCATCCCTGTGGCCCCTGTGACGCGAGCACTCACTCCCGTGCTCCCCCGACCCCCACGGAGAGTTGAGTTAAGGCCTGCGCCGCCTCCGTCGATACCGGCTGCCTCTGCATCCACACGGAGAGGAAGGGTAAGGCCTGCGCCAGCGCAGGCTTGCGACATCCGTTCGTCACTTGCGAAGATGGTGAACGAGTGGCCGGCGCTGCCACGGCCTAGGATTGCGGAGCCGCCTCTTTCGCCCCCGCGTGCTGCGGGGTCGCAGAGGCCAAACAATATGGCTGCTGGGATGGGGGGGGTGGATGACTGCCTCCCAAGCAGAGAGGAAATTGTGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCAATTCGTTCCGGAGACTGCATCCCGGTGCCAACAGCCACGGTCAGCCCGCGGGATCGGGCCGCCCGGCCGACCTCCGCTCCTACCCCACCTGCGAGAGTGGTTCGGCGTGGAGGCCGGAACCAGAACAACAGGGGTGTGAGGGACTCCCGCCCCACGGTCCCAACCACAGCCTCGTCCCCTTCCTCCTCCCCCATCAAGCATGGACGAAGGCTGGACGGAAGTGGTGAGGCGTGGCACCCAGGCATGGCGACAGACAGCGGCTCTGGCAGCTCCCGGGGGAGTCGAGCGCCGACCGCTGCAGCCCGTAAAACAGCGCTAGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTGGCAAGAAGAAAAGCAAGAAGAAGAAGCCGCGTGCAGCGCGGTCGGCTGCCGTTGTAGTGACATTGCTGCCGGCCGCAGCCGAAAAGGGCGTTACCTATAGTAATGTGATGGCCCGGGCGCGCGCGGCTGTAAATTTGAAAGAAATCGGGGCAGAAGAAGGCCTCCGTTTCCGGCAGATTGCCAATGGGGCGAAGCTGCTGGAGTGTCCCGGTGCCGACAGCTCTGGCATCGCAGAAAAACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAAGAGGAGGTGGCAGCCGCGATAGCCGCCCAGGGTGGATGTGCTCCAGAGAGTGTGACCGTGGGTGAACTCCGCTCAGGGTACTCCGGGGCCAGGTCGGCGTGGGCGCGCTGCCCGGTTGAGGCGGCTACCTTCTTGGCCACTCCTCCACCGGGAAGATCGACGGGGGATCCAGGGAGACTGCGAGTGGGCTGGATAGCGGCCCACGTGCGTCTTCAAGAACCGCGGGCCTGGAGATGCCTGCGGTGCTTTAGCACTGGACACGGCCTCGCCAGGTGCACCAGCTCGGTTGACCGCAGTGGTCTCTGCTTCCGATGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCAGCCGGGCGCGGGGCAAACCATCGGGCAGGAGGCAAAGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGTCGCAAGGCAAAGCGCCGGCAGAAGAGAAAGTTGGTCAGAGGAGCACTGGCCAACGTTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAATCACTCCGCCAGAACTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCATACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGACGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCTCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTTGCTCCCCGCCCAGTGATTCCCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGTGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTTATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTTGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATCCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGTGCCGTTTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGAGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACAGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTATACTAGCTGGGACGCCGCCTTGGATTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGTATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGAAACGAGTTGTCGTTGCCGAGTGTCGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCTCCGTCGAGTGAGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MTMANCEKLVPQEGTARESGGESLRASTSVEARCSTYSGGGNNCQDEGGCATGSRIPVEPTRSLIAGSMRFALASDSGAIIPTKPSAGKKRGRRKTPVVTSDDGGASSSSTEVPEKIMAIEDVAPVISGPAASKDTMPAPQRAPVRRRGAVSPATSVESMSTSVASLASGDETFRDLDLALVNLGKLLSTVAAMGAQPGSSYRKRLREGAAMVRTRLIPTMSKLYDLVASREAENKGLVAQLDSRESRIPGDSSASRGETSLSPMPTLACSGPSVGTMDTNVPSQAAMSVAAPMTAPIPVAPVTRALTPVLPRPPRRVELRPAPPPSIPAASASTRRGRVRPAPAQACDIRSSLAKMVNEWPALPRPRIAEPPLSPPRAAGSQRPNNMAAGMGGVDDCLPSREEIVACISRAVAVEVGKHFAGLEEMLRSSIRSGDCIPVPTATVSPRDRAARPTSAPTPPARVVRRGGRNQNNRGVRDSRPTVPTTASSPSSSPIKHGRRLDGSGEAWHPGMATDSGSGSSRGSRAPTAAARKTALAAVAAPREGRAPAAGKKKSKKKKPRAARSAAVVVTLLPAAAEKGVTYSNVMARARAAVNLKEIGAEEGLRFRQIANGAKLLECPGADSSGIAEKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARSAWARCPVEAATFLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRGANHRAGGKACFPSGDNTERNRRRKAKRRQKRKLVRGALANVVIPAAAPVPEGGGSGNLNHSARTQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDDGLAAIVIRRDAAIPLLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVIPAGDLNAKSVAWGSPRSDARGRLLERWVNAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRLFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTCRFYTGVVRSMALYEAPVWGQSLAAGVAKLLQQPQRTIAVRVIRGYRTISFEAACILAGTPPWILEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVYWVNRDRGRLTFRLTQVLTGHGCFGNELSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRLRRVRAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=6.90519e-11,     Score=167

Ontologies

Topology

Length:
1483
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0808200000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00184
outside
1  -  1483
 
 

Population Genetic Test Statistics

Pi
235.449269
Theta
140.617838
Tajima's D
1.496362
CLR
0.236735
CSRT
0.787660616969152
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号