SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13485
Pre Gene Modal
BGIBMGA014553
Annotation
unnamed_protein_product_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.625
 

Sequence

CDS
ATGAGAGGTACCGGGGAAATCAAATACCCGGCGCGGACCAAAACTGGCCTGAGTGTGACTACTCAGGGAAGAGAAATGGAAGAGGAAGAACAGCCAGTTATCACCGCGTACTCCGGTGATAACGACTACAGTGATCAAGGAAGTATAGGAGAGAGCTTTGAGGTTTCCAGTGTGACGATACTGGAGAAAGACTGGGAACAGGTGGAAGACCCGTTTAAAAGAAGGGAGTCAATCAAACGGACGCCCCCAGGGGCATTAAAAGAACTTAAGACACCCAGACTGATGGAGCGGGTAACTATAAGATACAAGGACGATACAAATAAACCAACCGAAATGGAGCAAAAGTTTGAAGCCTACAAAAAGGAGCAAGAAGAAAAGATCAGGAGACTAGAACAGGAAATTAAGGAACTTAAGACACTGCATAAACGAGAGACTGGAGAGAACCAACTTTTCAAGCTTGACGATCAGATGATTAACAGCTATGACGACTTCTCGAAAGTTTCAAGCATGGACTGGACGCAGGATAGTTACAAAAGGACAAAGATAGGCCATGGAGACATCTTTCTGAGAACCACCGACTGTACAGTCTACTTCTGTGATGAGAGGGAGAAAGCACACTCGAGGCTGACAAGAAGGGTGCTAAGCCGATATCCAGAAGTGACTAAGAGCGAGAAGATGGCATGCGCAGGAGGAGCATACGTGACGGTGGAACGAGAAACCACCATCAAAACAAAAGAGGGGAGACAGACAGACAAAACGAGTGCTGTGATCATGTTCCATGATGCGACCAAACAGGACGGCCGAAGTCAAAAGGACATGTATGAGCTCCTGTCCGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTGACTATTATAAAGCCCCAAGGAATCGATACAGGTGTAATAAGAAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCGAATTAGAATTAAGGACACCTAAAAAAGGAGAAAACACAAACAATACGGAAACAAGAAAACGGGACGAGGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCATCCCTAGAAAACATAAAAGGTGTAAAAAAGACAGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACTGGAAAAATAAGAGAAATGATGCGAGATAGAAAGGTAAGAAGAACTGGGGGGAGCAAGAAAAAAGTATTACACATAAAAGGAATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAAAAGTGGACAGCTTGGAGATAAGATCACTGAGACCGATGGGCGGTGGAAACCAGACGGCAACGGTGATCCTGGATGAAGAGGATGCAGGAAGGTTGCTTGCGGGTGTGTTACAGATAAATATAGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAGTATGAGCGCGGATCTAGTGATGCTATCTGAACCCAATAGAAAATTGGCAAAAGCTGCTGGATGGGAGTGTGACACCAGGGGAGATGCAGCCCTAGTTCTTCTTAATAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTCGTTGGGTTCAAGATGAAGCACTTTGCCGCGTTCAGCTGTTACATCTCTCCCAACTGCAGTTTTGAGGAGTTCAAAGCAGACGTCGATGAGCTTTGGACACTACTAAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGCAACCAACAAAAGGGGCCACTACCTGTTGGAAATGGTGGCGGACCTTGACATTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCTAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATTAGTAATTGGCAAGTGCGCGACGAGGAGACAATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCTATCCCAGTGCCATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCAGTAAAAGCCTGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGATGCTTCTATGCCAAAGCAAAACAACCGCAAGAAAAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGTACACAAGGAATAACAAAAAGCTAGGAAAAGGGAAAGACAGGGAAAATAACGAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAATAGTGTCAAAAAAGCTACGCGGAAACTCACCGATAAATATGGGCATGGCACAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGACCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGGCAGAATAGAAAAACAACTAGTACAATCGGACTGTTTACAAGATTCGCAGTACGGGTTCAGAAAGGGGAGGTCCACAGTGGATGCAGCCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGTAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCTCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGCATCATACTGACAGACGCTGAGGGAGGGGTCGTAGTGAAAAAGGTTACCGGTGGTGTTCCGCAGGGGTCGATACTGGGCCCCACGCTGTGGAACATACTGTATGATGGGGTACTGCGCCTCGAACTGGGGGATGGGGCACAATTAATAGGCTTCGCGGACGATTTAGCTCTGGTGGTGTCAGCAAAGAAGGAAGCAGAACTAATGGCAATAACGAATGTAGCCCTACAAAAGATCAGCGCTTGGATGAAGCAAAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTGCTAAGTGGGCGAAGAAAGCTTAGCGAGATTTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTGAAATACCTCGGGTTTTGGTTTGACAAAAGTCTGAAGTTCGGCAAACACATTGAAGAAACAACTGGTAAAGCCGAAAGACTGACGACCGCCCTTGGCCAAATCATGCCCAGGAAAGGAGGGCCGAGGTCGAGCAAGCGCAGACTATTGGCGTCCGCAATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAAGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACCATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGTAA
Protein
MRGTGEIKYPARTKTGLSVTTQGREMEEEEQPVITAYSGDNDYSDQGSIGESFEVSSVTILEKDWEQVEDPFKRRESIKRTPPGALKELKTPRLMERVTIRYKDDTNKPTEMEQKFEAYKKEQEEKIRRLEQEIKELKTLHKRETGENQLFKLDDQMINSYDDFSKVSSMDWTQDSYKRTKIGHGDIFLRTTDCTVYFCDEREKAHSRLTRRVLSRYPEVTKSEKMACAGGAYVTVERETTIKTKEGRQTDKTSAVIMFHDATKQDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVIRKMLEVLFRGKDIELELRTPKKGENTNNTETRKRDEVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMRDRKVRRTGGSKKKVLHIKGMDSSVEMEEVREDLKSTNLIKKVDSLEIRSLRPMGGGNQTATVILDEEDAGRLLAGVLQINIDRGKAAHDLLLATASSMSADLVMLSEPNRKLAKAAGWECDTRGDAALVLLNKTLTVSEIYRGKGFVGFKMKHFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKATNKRGHYLLEMVADLDIVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVRDEETMSGHKYIAYEIKHVLPLSQCHAQMKRWNLQRLDVDKFSKSLKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRYTRNNKKLGKGKDRENNEENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKIVSKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDRIRLVLQKVLESGVFPNSWKTARLVLLRKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKQLVQSDCLQDSQYGFRKGRSTVDAANKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGGVVVKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAQLIGFADDLALVVSAKKEAELMAITNVALQKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGFWFDKSLKFGKHIEETTGKAERLTTALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWAKVMNVAKYRNMYSKVQRQLAIRICGAYRTISLDAVLVIAGL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=4.89402e-10,     Score=159

Ontologies

Topology

Length:
1290
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.8119
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1290
 
 

Population Genetic Test Statistics

Pi
169.267021
Theta
155.685722
Tajima's D
-1.124116
CLR
52.790898
CSRT
0.111644417779111
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号