SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13484
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.383 Nuclear   Reliability : 1.109
 

Sequence

CDS
ATGGAGCGTCTGGAAGTTTTCCTTAAAGACATAGGAGGGGCGAGAGTAATTGTGGGAGGTGACTTCAATGGATGGCACCCATCGTGGGGGAGCGTGAGGGTGAACCCCAGAGGCTCATCACTAGTCGAACTAGCGCACAGCAACGATTTATACATTTGTAACTCAGGAGACACTCCAACCTTCGAAACCATCACTCATGGCCGCAATAGATCATCCATCATCGACCTTACTCTTGCATCCAGCGACCTCTTCAACAGCATCTCTGAATGGCACTACGTCCTGGGAAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACCTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCATCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTCCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACAATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGA
Protein
MERLEVFLKDIGGARVIVGGDFNGWHPSWGSVRVNPRGSSLVELAHSNDLYICNSGDTPTFETITHGRNRSSIIDLTLASSDLFNSISEWHYVLGKASRIFNKLCLYSRPTWGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFIPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSRRAHTQKHYYQN

Summary

EMBL
RSAL01000249    RVE43511.1    AB046668    BAB21511.1    D38414    BAA07467.1    + More
NWSH01001820    PCG70022.1    AB211537    BAE44464.1    GFAH01000444    JAV47945.1    NCKU01007943    RWS02258.1    KZ149985    PZC75691.1    MUJZ01028333    OTF78340.1    GFTR01008639    JAW07787.1    IAAA01038678    LAA08500.1    KP771712    AKU04650.1    KK121445    KFM80483.1    KK115320    KFM64783.1    KK119855    KFM76920.1    KK115566    KFM65430.1    KK116791    KFM68755.1    GBBI01004920    JAC13792.1    GEFM01006389    JAP69407.1    KP771711    AKU04648.1    KU543676    AMS38357.1    AF015813    AAB94039.1    GECZ01013919    JAS55850.1    GDAI01000743    JAI16860.1    MAYS01000558    OFC59623.1    GANO01003537    JAB56334.1    GANO01003141    JAB56730.1    X59239    CAA41925.1    U73803    AAB92394.1    GFTR01008411    JAW08015.1    GANO01003496    JAB56375.1    AF015489    AAB94030.1    KU543680    AMS38365.1    GACK01003634    JAA61400.1    GGLE01001887    MBY06013.1    GAPW01000103    JAC13495.1    GANO01003538    JAB56333.1    GANO01003539    JAB56332.1    IACF01003273    LAB68896.1    PABS01000003    MAT33547.1    GDAI01000752    JAI16851.1    GDAI01000751    JAI16852.1    IACF01002963    LAB68595.1    GFTR01008541    JAW07885.1    IACF01001499    LAB67197.1    CR848788    BX908731    LBMM01010475    KMQ87436.1    U87543    AAB65093.1   
Pfam
PF00075   RNase_H        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR036397   RNaseH_sf        + More
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=1.11498e-09,     Score=152

Ontologies

Topology

Length:
426
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.67297
Exp number, first 60 AAs:
0.00249
Total prob of N-in:
0.02275
outside
1  -  426
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号