SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13469
Pre Gene Modal
BGIBMGA010869
Annotation
PREDICTED:_dual_specificity_protein_kinase_splB_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.607
 

Sequence

CDS
ATGCATCTCACAATGAGCGTTGTCATCGACACGAACAACAAGAGAGTCACAACGCCTAGTAGTACAAACGCGACCAGGGATTCACAATTGTTTTCGTTGCTTGCTGCTCGAAGAAGGTTGCTCCTCAGCGGAAGACTGACGTCACACATTAATACCTTAGCTGCTATAACACACAAGCCTCATAAAACAAACACAACGTTCGCCCACCTAGAAGTAAAACATGGAAACAGCTCTTTGGTAAGGAAAGTAATCTTTGATAATTCAAGCAGAGAGGCTGGCACTCCTGTGACGCTCAAACTGATCACTACAGACGGAAGCAGGGAAACAAGACAAGATATTAAGCCACATGAAATAAGACATATTTTTATACCTAAATTAAGCCCAGAAAATAGGAATAGATCAGGGTATAGAAGACGAGAACCAACGAGTATACTTAAAAGTGTTACGATTCCTGAACAAGCGACAGAAGGTAATATAGTGTATGTTCCACCAGATAAAATAGAAGAAGAAAAAGATGTTGATTTAGATCCAGAAGAAGAATTCCAAGTAGACGAATCCAACCATGGACTGTATTTATTAAATTATTCTGACACTGATAATGTCACTCAAGGACCAGATATAAATAAAACTACTATCAGTAACGAAATAGTCAAAGAAAATACTTCTACTATAATTAAGCCAACTACCATTATAATTGTTGAAGATTCCAAAGAAAATGACACTATTGAGTCTAAGGAGGATGAAATTACTGAAATCAATACTATAGCAAATAGTACAGAACAAAAAAATTATACGTTGGCTAAAAATGATCTTGGGAAAACTGAGAATCAAACTTTGTTTTTGTCGGATGAAATTTACAATCATTTTAGACCTCTAGAAACAGAATTACCAGTTGAAGATATGGCACCATTTATATATTTTGGAAAAAAATTGGGCGGTACCGGCATAAGTGATAATTTAACAAACTCTCCATCTTTTTCCGCCTCCACAAAAACAATAAATTATTTGGCTCCACCCCAAGAGAAAAGAAAGTTCAATTCTAGGTATTCCGCCACAGAGAAATATAAAAATTCAAATGCCGATGAAGATGAAATCAATGAAGATATGGATGTAAATTTATTGAATAAGAAGACCAAAGAAATAGACACGGAGTACGAAGGGTATTTCGATGACGCTGAGGTTAAGAAGGAATCTCCTATCACTCCGGTGGCGAGGCCTCCGCTACCTCCACCCACCAAACCTGATCAAAAATGGGAGTTCCCGAGAAATAAGTTAAGACTACAGACGTTACTGGGCCAAGGGAATTTCGGGCAGGTCTGGAAAGCAGAGGCTGATGATTTAAACGGGCACGACGGGCTAACCAGACTAGTGGCAGTAAAAACGATCAAGGAAACGGCATCGCAGAAGGAGAAACAGGAGCTACTCCATGAAATCTACATCATGCAAAAGATCGGGACGCACCCCAACGTCGTCACGTTACTTGCCTGTTGCACTGAACAAGAGCCATATCTGCTGATAATGGAGTACGTGATGTGCGGCAAGCTGCTGACGTACCTGCGGGAGCGCCGCGCGCGCCCAGACAGGTTCGCGGGCAGCGGCGCGCTCACCTCGCGCGATCTCACCGTGTTCGCCTACTGCGTCGCCAGGGGGATGGACTATATCGCCTCTAAGGGGATAGTGCACCGCGACCTGGCGGCCCGCAACGTGCTGGTGGACCACAACAAGCTGTGCAAGATCGCGGACTTCGGCATGTCGCGGTGCGCGGGCGCGGCGCGCAACCCCCGGACCGCGCTGCCGGTGCGCTGGATGGCGCCCGAGGCCCTGCTCTACTCGCACTACTCGCACCACTCCGACGTCTGGGCCTTCGGGATACTGCTCTGGGAGATCGTCACGCTTGGCTCGACTCCGTACGCGACGATGTCTGGTCGCGAGGTGCTGGCGGCGGTGACGGAGGGCTACCGGCTGGAGCGGCCGGCGCACTGCAAGCCGCAGCTGTACCGCGCCATGCACTCCTGCTGGCACGCCGACCCCGCGCAGCGCCCCGCCTTCTCCGCGCTCAAGGCGCAGCTCGCCGACCTGCTGCACAACGAGACCGCCGAGGGGAACTACGTCGACCTCGACTCGTTCTACCAGGACTCCTCCGTCTACAGCGACCCCTCCGCCATCATCCACGACGACGACGGGCTCTCCGCCGAGTACGACCGGGAGAGGCGCTGCTTTAGAGAGTTAACAAGTACGCCGTCGCAGTTCGATAACCGAGCGTTTAACCTTCGGGACGAAGAGCTCCGGAACAAGTTTGGTATTGGAACTCCTCGGATGGGCGGCTTCGGCATCAGGGACGTGCCCTTCAACGAGAGACCCTTCTCAGACGCCGAGTTCAACGACCGACCTTTCGCTGACAAAAATTTCACCGACAATAATTTCAACGACACGAACTTCACCGAACGTAAGGACGGGAAACTATCTACTTCCAGTTTTCACAGGGAAAGGGAGAGAGAGAACCCTTTGGTTAGTAGGAATAGCTTTAATGGATTTCCGAGGATTGGCACTAGGGAAGGGCACTTTCAAATTACACCAGATGGTAGGAATAAAAGAGTTCCAGAATTTGAATGTGATATTTGA
Protein
MHLTMSVVIDTNNKRVTTPSSTNATRDSQLFSLLAARRRLLLSGRLTSHINTLAAITHKPHKTNTTFAHLEVKHGNSSLVRKVIFDNSSREAGTPVTLKLITTDGSRETRQDIKPHEIRHIFIPKLSPENRNRSGYRRREPTSILKSVTIPEQATEGNIVYVPPDKIEEEKDVDLDPEEEFQVDESNHGLYLLNYSDTDNVTQGPDINKTTISNEIVKENTSTIIKPTTIIIVEDSKENDTIESKEDEITEINTIANSTEQKNYTLAKNDLGKTENQTLFLSDEIYNHFRPLETELPVEDMAPFIYFGKKLGGTGISDNLTNSPSFSASTKTINYLAPPQEKRKFNSRYSATEKYKNSNADEDEINEDMDVNLLNKKTKEIDTEYEGYFDDAEVKKESPITPVARPPLPPPTKPDQKWEFPRNKLRLQTLLGQGNFGQVWKAEADDLNGHDGLTRLVAVKTIKETASQKEKQELLHEIYIMQKIGTHPNVVTLLACCTEQEPYLLIMEYVMCGKLLTYLRERRARPDRFAGSGALTSRDLTVFAYCVARGMDYIASKGIVHRDLAARNVLVDHNKLCKIADFGMSRCAGAARNPRTALPVRWMAPEALLYSHYSHHSDVWAFGILLWEIVTLGSTPYATMSGREVLAAVTEGYRLERPAHCKPQLYRAMHSCWHADPAQRPAFSALKAQLADLLHNETAEGNYVDLDSFYQDSSVYSDPSAIIHDDDGLSAEYDRERRCFRELTSTPSQFDNRAFNLRDEELRNKFGIGTPRMGGFGIRDVPFNERPFSDAEFNDRPFADKNFTDNNFNDTNFTERKDGKLSTSSFHRERERENPLVSRNSFNGFPRIGTREGHFQITPDGRNKRVPEFECDI

Summary

Uniprot
ProteinModelPortal
PDB
5XFJ     E-value=8.30544e-67,     Score=648

Ontologies

Topology

Length:
873
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02357
Exp number, first 60 AAs:
0.00216
Total prob of N-in:
0.00016
outside
1  -  873
 
 

Population Genetic Test Statistics

Pi
5.103194
Theta
12.634301
Tajima's D
-0.935951
CLR
1.118967
CSRT
0.146042697865107
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号