SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13444
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.716
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACACAGTATATAAGAACGGATCCTGGCAACGAATTAAATAACCTCAGCCTAATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGACCAAAGAGATGAGACCGCTTTATACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGTATTGCCACAACCATCGAGGCAAAACGCGACCTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAAATACCACCTATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAACAACCACTGGAAACCTGCTTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGAGTAACCCTAAAGCGGTGGAGAAATACTACTCAAATATACCTCTTAAATATGACCCCTTCGAAGTAACGAACGTCCACGCTACAACTAGGAACGACTTCTCTATCACTATACCAGCTTTTTCAGAACTTAACGACGCGGGACCTATTAAACTGTTTGTCTACGATTTCCACAAATTTTTTGACGGACTTATTGGTTTAGACTTGCTTACCAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTTAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAGTACCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATATCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGGTATAATTGAAGTCGAAAACACATCGCATAACGACATAATATTTTCAATGGACCGCCCCATAGAAGCGTTAACGTTTAATATCGAGTGCAGCCGTACCGAACAAAGTCGTAGTCGCGTTGATCAGGTCTTATCGCGATTACGTACCGATCACCTTAATGAGGAGGAAAAAATGAATTTAATTAACCTCTGCTCGCAGTACGCTGACGTATTCTATCTTGAGGGTGAACCGCTCACCTTTACTAATAAAATAAAACACCACATTAGGACGACCGATGAAATTCCGATCTATACAAAAAGCTATCGCTATCCTTTTGTCCACCGGGAGGAGGTTAGAGATCAAATTTCTAAGATGCTGCAACAAAATATAATAAGACCCTCTGACTCAGCATGGAGCTCGCCTATCTGGGTCGTGCCTAAAAAGGCAGATGCATCTGGAAAACAAAAATGGAGATTAGTAGTAGACTTCCGTAAGCTAAATGAAAAAACTATCGACGACAAATATCCGATACCAAACATATCCGACGTTCTAGATAAATTAGGTAAGTGCCAGTATTTCACAACCCTGGACCTGGCAAGCGGATTCTACCAAGTGGAAACGAACCCTGAAGACATCCCAAAAACAGCGTTCAATGTAGAGCACGGACATTTTGAATTTTTAAGAATGCCGATGGGATTAAAAAATTCTCCGGCTACATTTCAAAAAGTTATGGATAACGTCTTGAAAGGTCTTCAAAACGTTATATGCCTAGTATATCTTGATTACATTATCGTTTTTAGCACATCTTTACAAGAACATCTTGTTAACCTCGAAAAAGTGTTTCAGAGACTTCGTGAGTCCAACTTCAAAATACAGATGGACAAATCAGAATTTTTAAAATTAGAAACAGCCTACTTAGGTCATATAATTAGCAACGAAGGAATTAAACCTAATCCCGACAAAATTGCCACCATACAAAAGTACCCGATACCAAAAACCACAAAACAAATTAAGCAATTCCTCGGACTTATAGGATATTATCGAAAATTTATACCCGACTTTGCTAAAATAACGAAACCATTCACACAGTGCTTAAAGAAAGGACGGGCTATAACCCTTAGTAAAGACTACATAGACTGTTACGAAAAGTGTAAGCAACTTTTGACTAACGACCCAATATTACAGTACCCTGATTTTACAAAGGAATTTATTTTAACAACTGACGCATCAAATGTGGCTTTAGGAGCTATATTGTCACAAGGCCCCATAGGCTCCGATAGACCTGTATGTTACGCCTCACGTACCTTAAATGAAAGCGAGATGAATTACAGTACAATCGAGAAAGAATTACTAGCAATCGTGTGGGCCACCAAATACTTTAGACCATATTTATTTGGCCGAAAATTTAAAATAATAACGGACCATAAACCACTACAGTGGATTATGAACCTTAAAGAGCCTAACTCACGTTTGACCAGGTGGCGACTTAAACTTAGCGAGTATGACTACACCATCGTCTATAAAAAGGGCAAAATTAATACGAACGCCGACGCCCTCTCGCGAGTAGAGATACATAACGAAGATGTAAGTTCCATGATAGCGAACCCTTCAGAAAAACCACCCTCAGTCACGGGTTCAACCACCGCCACAGCTCATACCAGTAATGAAAACCCCATATTAGAGGTCCCCATAACCGACGAACCACTGAATAAATTCTATAAGCAAATATGCATAACAGTGGTCGGAGACATCAAAAAACGACCCGTTATCAGTAAGCCATTTGAAACGCACACTCGCATATCTATACAAGTTTCCCAATCAAACTTAAGAGAAGACGTCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCCATAATTCAAGACACGTTCAGAAATTCGGCAATGAACCTCCTACTCACAAAGGTCGAATTAGAAAATGTGAAGGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAACGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACCATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACCTAATGACAATGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTTCACAGTTTCACCAAATGTCGCCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATTGACATAACAGCCCATTTACTGCAACAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCGCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAACCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGCTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCCCGACTTAAACGTGCACATAAAGACTTCCGATTGTTACAGGATTCTACTGAACCTCCTGACCCGACATCTGACGACCGCACACGAGATAAAACTTGA
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPPMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWSNPKAVEKYYSNIPLKYDPFEVTNVHATTRNDFSITIPAFSELNDAGPIKLFVYDFHKFFDGLIGLDLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRVPINSSDGEVYIPQQYLNNCVVNECITTVVKNRGIIEVENTSHNDIIFSMDRPIEALTFNIECSRTEQSRSRVDQVLSRLRTDHLNEEEKMNLINLCSQYADVFYLEGEPLTFTNKIKHHIRTTDEIPIYTKSYRYPFVHREEVRDQISKMLQQNIIRPSDSAWSSPIWVVPKKADASGKQKWRLVVDFRKLNEKTIDDKYPIPNISDVLDKLGKCQYFTTLDLASGFYQVETNPEDIPKTAFNVEHGHFEFLRMPMGLKNSPATFQKVMDNVLKGLQNVICLVYLDYIIVFSTSLQEHLVNLEKVFQRLRESNFKIQMDKSEFLKLETAYLGHIISNEGIKPNPDKIATIQKYPIPKTTKQIKQFLGLIGYYRKFIPDFAKITKPFTQCLKKGRAITLSKDYIDCYEKCKQLLTNDPILQYPDFTKEFILTTDASNVALGAILSQGPIGSDRPVCYASRTLNESEMNYSTIEKELLAIVWATKYFRPYLFGRKFKIITDHKPLQWIMNLKEPNSRLTRWRLKLSEYDYTIVYKKGKINTNADALSRVEIHNEDVSSMIANPSEKPPSVTGSTTATAHTSNENPILEVPITDEPLNKFYKQICITVVGDIKKRPVISKPFETHTRISIQVSQSNLREDVINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPNDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIKNPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFRLLQDSTEPPDPTSDDRTRDKT

Summary

Pfam
PF00078   RVT_1        + More
PF17917   RT_RNaseH
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF02902   Peptidase_C48
PF12259   Baculo_F
PF01661   Macro
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR003653   Peptidase_C48_C       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR038765   Papain-like_cys_pep_sf       
IPR002589   Macro_dom       
IPR022048   Envelope_fusion-like       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF54001   SSF54001       
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.15839e-70,     Score=683

Ontologies

Topology

Length:
1484
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02601
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00064
outside
1  -  1484
 
 

Population Genetic Test Statistics

Pi
19.847954
Theta
21.146973
Tajima's D
-1.33108
CLR
18.000866
CSRT
0.0818959052047398
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号