SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13434
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.286
 

Sequence

CDS
ATGCCAGATTCACTGTGCGCATGCGCATTGGAACAGCAGTGTTTTAAGACGGTATGTAATCAGCAGCCCACTAAAACTATATTGCTTGGTACAGCGATATGCAATATTATGGACAATTCAGGCACGTTCTTGAGTACTGCCCGAATATTGGTAGATAGTGCATCGCAACGAGATCTGATTACTCTTGAATTTTGTAAGAGACTTAATTTACCAATTTATCCTTCCGAAACAAAGCAAGTGTGCGGAGTGGGTGACGTGAAAAATTCCATTGAAGGATATTGTTGTCTAACACTTTGCTCTTGTACTGAAGAATCAGTGCGTATTACAATACAACCTCTGGTAATCAATAAAATTACAGGTGAACTTCCTACCTCAAAGATCGATACTTCAAGTCTTAATTATCTAAAACACATTAAGCTAGCTGATGACAGATTCTCACAGCCTCGTGGTATAGATTTGATTGTGGGTTCCGATGTATTCTCTCGAATTTTACGACCTCATATAATTTCTAGGACCCCCGGTGAACCTGTAGCAATTGAGACTTCATTAGGTTACATAATAGTCGGCCAGGCACCGGTATTAGCTCCCTCGATAGATAATTCATACTATACACATTGCACCTTTGGTGAGGACAATTTGGATAATGAGAATAATGCTTGTATTGGTAATTTTTTGAAATTAGAGGATATTCCAGACGTCAAGCCATACACGGAACAGGAAGAGGCGTGTGAAAGCCTTTATAGACAAACGACTACTCGTGATAGCTTAGGTCGTTACATTGTCTCGTTACCATTCAAAGATACTCCTAGTAAGCTGGGTGACTCATTGCAGGCATCAATGCGTAGATATCTTTCATTGGAACGTAAGCTGCTATTGCAACCCGAAATGAGACAAGAATACGATAAAGTCATTAAGGACTATTTAGAAAAGGGATATTTAAACCCATGTTCTAGAAATATAAATGAGTCCTCACTCCAGTATGTTATTCCCCATCACGGCATCGTTCGAAAAGATAAAAGTACAACAAAATTACGGGTAGTATTGGATGGCAGTATGAAATCATCATCGGGACTGGCACTGAATGATATATTACAAGTCGGACCGAATTTGCAAAACGACCTTTTTAGAATAATTTTAAATTTCAGACTTTTTAATGTAGCGATTAGTGCCGACATTAGGCAAATGTACTTAAGGATTTTAGTAAAGGACGAAGATAGGAAATTCCTGAGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAGATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGTCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATTTGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGGGCTAATAATATAGATTGGGATGAAACTCCTCGCCCTGAAATTGTAGCAGCTTGGCATCGATTCGTGTCTGAGTTGCCAATATTGGAAAATGTTAGAATACCACGACATACTGGCATTGTTATGGAGTGCATAGTTAGCTTATTGGGATTTGCTGATGCATCTGAAAAGGCCTATGGAGGTGTCGTTTATTTACATGTTTATTTTCCACAAACAAATAAGTTCACTATTACGCTTGTTTGTGCCAAATCCAGAGTAGCGCCGTTACGATGCGTGTCATTGGCAAGACTAGAATTATGCGATTGGCCAGTTAAGAATTTTGATGCCACATCGATGACTGATATTCCAGAAATGAAACCAGCTATCATGCTATTCACAACTGATGATGCACGGAATGACAATATATTATACACGCTTGCATGTCGTATTTCATCATGGCCCAAGCTGGTCCGTATTGTACTTTATGTTCTCCGGTTTATTAAATTGGTACCGAGTAAATTTGATATTTCCCATTTAAAGGTGGCCGAAACGAATATCATCAAGGCTGTACAGCGAGTTCACTTTGATAAAGAACTTAAGAATGTGAAGTCTGGCAAAATATTACCGCCTGCATTTCAACGGCTCAGAGCCTTTGTTCACGAAGTCGAAGCTTGA
Protein
MPDSLCACALEQQCFKTVCNQQPTKTILLGTAICNIMDNSGTFLSTARILVDSASQRDLITLEFCKRLNLPIYPSETKQVCGVGDVKNSIEGYCCLTLCSCTEESVRITIQPLVINKITGELPTSKIDTSSLNYLKHIKLADDRFSQPRGIDLIVGSDVFSRILRPHIISRTPGEPVAIETSLGYIIVGQAPVLAPSIDNSYYTHCTFGEDNLDNENNACIGNFLKLEDIPDVKPYTEQEEACESLYRQTTTRDSLGRYIVSLPFKDTPSKLGDSLQASMRRYLSLERKLLLQPEMRQEYDKVIKDYLEKGYLNPCSRNINESSLQYVIPHHGIVRKDKSTTKLRVVLDGSMKSSSGLALNDILQVGPNLQNDLFRIILNFRLFNVAISADIRQMYLRILVKDEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPVEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSLWANNIDWDETPRPEIVAAWHRFVSELPILENVRIPRHTGIVMECIVSLLGFADASEKAYGGVVYLHVYFPQTNKFTITLVCAKSRVAPLRCVSLARLELCDWPVKNFDATSMTDIPEMKPAIMLFTTDDARNDNILYTLACRISSWPKLVRIVLYVLRFIKLVPSKFDISHLKVAETNIIKAVQRVHFDKELKNVKSGKILPPAFQRLRAFVHEVEA

Summary

Similarity
Belongs to the G-protein coupled receptor 1 family.
EMBL
GBHO01005525    JAG38079.1    GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    + More
GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GALX01004947    JAB63519.1    LBMM01012238    KMQ86334.1    GEZM01085145    GEZM01085143    JAV60187.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    LBMM01009202    KMQ88311.1    ABLF02008594    ABLF02030854    ABLF02067347    GGMR01002421    MBY15040.1    ABLF02025193    ABLF02041863    GGMR01018294    MBY30913.1    GGMR01017890    MBY30509.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    ABLF02009779    ABLF02067216    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GFTR01008874    JAW07552.1    GECZ01008071    JAS61698.1    GALX01000776    JAB67690.1    GGMS01014443    MBY83646.1    LNIX01000074    OXA36769.1    GGMR01002219    MBY14838.1    GBHO01000060    JAG43544.1    LBMM01009551    KMQ88039.1    GEBQ01004229    JAT35748.1    KK114194    KFM61875.1    ABLF02039606    ABLF02066034    GBHO01000061    JAG43543.1    GGMR01011131    MBY23750.1    ABLF02054908    GBHO01000059    JAG43545.1    LNIX01000036    OXA39969.1    ABLF02036131    ABLF02041527    ABLF02064049    GDHC01014268    JAQ04361.1    GGMS01010524    MBY79727.1    GAMC01006864    JAB99691.1    GDHC01019528    JAP99100.1    GBHO01007689    JAG35915.1    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    LNIX01000069    OXA36894.1    LNIX01000007    OXA51795.1    LNIX01000002    OXA59522.1    GBBI01004211    JAC14501.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    ABLF02005251    ABLF02055296    LNIX01000018    OXA45284.1    KQ458473    KPJ05885.1    GDHC01016727    JAQ01902.1    GBHO01006408    JAG37196.1    GGMR01017803    MBY30422.1    AXCM01013330    GGFK01004613    MBW37934.1    GBHO01044316    JAF99287.1    GBHO01007061    JAG36543.1    GBRD01007977    JAG57844.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GGFK01004563    MBW37884.1    LNIX01000016    OXA46198.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GGFK01004538    MBW37859.1    GBHO01038800    JAG04804.1    ABLF02006304    ABLF02036268    JXUM01113346    KQ565681    KXJ70776.1   
Pfam
PF05585   DUF1758        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF17921   Integrase_H2C2
PF03564   DUF1759
PF00078   RVT_1
PF00001   7tm_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR036397   RNaseH_sf        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
806
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.20763
Exp number, first 60 AAs:
0.01559
Total prob of N-in:
0.00123
outside
1  -  806
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
27.676679
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号