SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13432
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 3.993
 

Sequence

CDS
ATGAGCGATAGCAGTGAGTCGGCGAAAACTGCTAGTTCACATCAGAATACCAACGTGACCACACGGCGAAAACGTCGAGTGCGCGTTTCCACTGACCACAGAGATACGGAGGTGCGAATTTTAAAAATTAAAGTTCCTCCGTTTTCGCCCGAGGATCCAGAATTGTGGTTCGCCTTGCTGGAAGGTCAATTCGACGGTCATAACATCACTGATGACGTCATAAAATTTAATAACGTCACCAATAAGTTAGACCTCCAGTACGCAAAGGCCGTGAAAGATATCATTATCAATCCTCCGGCAAAGAACCGTTACGATAAAATTAAATCCGAACTAATAAAGCGTCTTTCCGCATCACACGAGAAGAGAGTCAAACAATTGCTCACTTATGAAGAACTTGGCGACAGGAAGCCTTCACAGTTCTTGCGACATCTTCAAGACCTGGCTGGACCCTCTATACCTGATGACTTCCTCAGGTCGATATGGTGCAATCGTCTCCCGCACAACATTCAGACGGTACTGGCGTCACAGCCAACCCATTCTCTGGAGCAGTTGGCAGACTTGGCAGATCGCATCCAAGAGCTCGCGTCGCCTTGCAACGTCGTCACTGCGTCTACTAGTAGTATACACGCTTCTTCATCGCAGTCTAACGAGATCGCGGAGCTGAAGAAGATGGTGCAGCACCTCACCCTGAAGCTAGAGGAGCATACTCGAGCAGCCTGCTGCTACTCTACTGATCGTTCGAGACCACGCGATCACCGTCGCTCACCATCCCGACAGCGGAGCCGAAGCAATTCCAGCTACCGAAACTACCCCATATGCTGGTATCACAGCAAGTTTGGTGCACAGGCTCACAAATGCCTAAAGCCTTGCGATTACGGCAAGACGGGAAACGACGTTTCGACAGGTGACACGCGTTTCCACGCCATTTTAAGTAAGTACCCGGAAATTACACGCCCGGCAGGTACACCGGTGTCTCCAAAGCACAACACAGTACATCATATCAGGACCACACCCGGCCCTCCTATCTCAAGTACCCCCCGTAGACTGGCACCGGACAAACTTAAAATAGCCAGACATGAGTTCGAGCTCATGCTCAATAACGGCACAGCGCGCCCTTCTGAAAGTCCCTGGTCTTCTCCCTTACACCTTGCAGCTAAGAAGGATAATGGCTGGCGACCTTGTGGCGATTACAGGATGCTTAACTCACGGACTATCCCGGACCGTTATCCCATTAAACACATCCATGACTTTGCCCACTCCATTTCTGGTTGTAAAGTCTTCTCCACCATCGACCTCATGAAGGCTTACAATCAGATTCCGGTCTTTGAGGACGACATACCTAAGACCGCCATCACTACTCCCTTTGGCCTGTATGAATTCCCTTTTATGACCTTCGGGCTAAGGAATGCTGGCCAAACATTCCAAAGGTTTGTTGACGAGATGACGAGAGGCCTCGACTTTTGTTACTGTTTCCTTGATGATTTTTTAGTTTTCTCTAAGGACGAAGATGAACATGAAACCCACCTTCATCAGCTCTTCAGCCGTATGAATAAATACAGCGTCGTCGTCAACACCTCCAAGTGCGTCTTCGGTGCACCAGAGATAACGTTTTTAGGTTACCGAATCTCTGCATCCGGCACCAAACCTCTGGAATCTAAGGTCCAGGCCATATCAGAGTTCCCGGTACCTAAGACTGTTAGACAACTCAGGCGATTTTTGGGAATGGTCAACTTTTACAGGCGATTTCTACCTCGTTCCGCCGCCATTCAAGCCCCTTTAAATGCGTTACTTGCTGGCAACGTCAAGGCGTCGCACCCAGTTGACATTTCGGGTGATACCCTGTTGGCTTTCGACGAGTGTAAGGAAAGTCTCGCCAATGCCGCATTACTGGCACACCCAGATTGTCAGGCCGACCTCGCTCTGGTAACAGATGCGTCCGACCTGGCAATGGGCGCAGTATTGCAGCAATATAAAAATAATGTTTGGGAACCTCTCGCTTTCTTCTCGCAGAAGTTGAGTCCCTCCCAACAAAAGTACTCACCATACGACCGAGAACTCTTAGCCATATATGAAAGCATCAAGTACTTTCGTCATATGTTAGAGGCAAGGCATTTCGTGGTGTTTACTGACCATAAGCCACTAAGTTACGCCTTCAGTGAAAAGAAGGCAAACTGTTCGCCTAGACAGTATCGTCACCTAGACTACATTTCACAGTTCACGACCGACATTAGACACATTTCAGGCAAAGACAACGTCGTTGCCGATCCACTGTCACGTGTCGATGAGCTGCAGGTGGCAGTCGATTTAGACGTGCTGGCTTCGTCTCAAGCGTCGGATATGGAGTTGACTCGACTCCTGGAAGGAGAATCTTCACTCCGCCTGAAAAGGTTGAGGGTTCCTAACTCTCGCACAGAGCTTTATTGTGACGTCAGCACCCCTACACCTAGACCGTTTGTCACTAAAGACTTAAGAAGACAACTTTTCGACAGTCTTCATAACCTCAGCCACCCAGGCGCTAACGCAACGGCTAAGCTTGTTGCTGAGCGATTCGTTTGGCCTGGAATGCGCAGAGACTGTCGACAGTGGTCTCGTCAATGTCAGGCATGTCAACGCGCCAAGATTCATCGCCACGTATCTTCTCCATTGGGCACGTTCGACCTTCCTCGCGCTCGATTTGCTTTTATTCACGTGGACATTATTGGTCCTCTGCCCGTTTCACAGGGCTACCGCTATTGTCTCACAGCGGTGGATCGTTTCACTCGTTGGCCGGAAGTCACACCCATGGCCGATATGACCGCCGAAACAGTCGGAAAGGCTTTAATATCGTGGATATCCAGGTTTGGATGTCCTACCGATATTGTCACCGATCGCGGACGACAGTTTGAATCGTCACTTTTCCAGTATCTTGGAAAATTTATTGGATTCAAACATCGCAGGACAACCGCGTATCACCCTGCCTGTAACGGGCTGGTGGAACGATTCCACCGCCAGTTGAAAGCAGCCATAATGTGCCACGCTGATTGCAATTGGGTAGATACGTTACCTTTAGTGCTTTTAGGCATAAGGAGCGCGTTTAAAGACGACCTTCAGTCGTCTTCTGCTGAACTGGTGTACGGAGAGCCGCTTCGTCTGCCTGGTGAATTTTTCCAGGCTACCGCTCCGGATTCTACCGATATATCGGACTTCAACTATCGCCTACGTCAGTTCGCAGCTAAACTCCAGCCGACACCAGCTGCACGTCACAATGACGACAACAAAATTTTTGTCCACAAAGATCTGACTTCGTCTAGTCACGTGTTTTTAAGGGACGATGCATTGCGTGGCGCTTTACAGCCACCTTACACCGGACCCTATGAAGTTCTCGAACGAGGTGAAAAGACTTTTAAGATACAGGTCAAAGGGAAGAGTGTTACTGTATCCATAGACCGCCTCAAACCAGCCTATATTTTGATTAACCCATCCCCCGATTCCACTCCGACTCTTACTTCCAACTCCTACCCTAGTTCTTTACCTAATCCTGTTCCCCCAGAGCAAAGAGCCCCAGCTCAGGGTGACGTCAGAAGAACACGTTCAGGCCGTACAGTTCGGTTTCCCGATTTTTATCGCCCGTAG
Protein
MSDSSESAKTASSHQNTNVTTRRKRRVRVSTDHRDTEVRILKIKVPPFSPEDPELWFALLEGQFDGHNITDDVIKFNNVTNKLDLQYAKAVKDIIINPPAKNRYDKIKSELIKRLSASHEKRVKQLLTYEELGDRKPSQFLRHLQDLAGPSIPDDFLRSIWCNRLPHNIQTVLASQPTHSLEQLADLADRIQELASPCNVVTASTSSIHASSSQSNEIAELKKMVQHLTLKLEEHTRAACCYSTDRSRPRDHRRSPSRQRSRSNSSYRNYPICWYHSKFGAQAHKCLKPCDYGKTGNDVSTGDTRFHAILSKYPEITRPAGTPVSPKHNTVHHIRTTPGPPISSTPRRLAPDKLKIARHEFELMLNNGTARPSESPWSSPLHLAAKKDNGWRPCGDYRMLNSRTIPDRYPIKHIHDFAHSISGCKVFSTIDLMKAYNQIPVFEDDIPKTAITTPFGLYEFPFMTFGLRNAGQTFQRFVDEMTRGLDFCYCFLDDFLVFSKDEDEHETHLHQLFSRMNKYSVVVNTSKCVFGAPEITFLGYRISASGTKPLESKVQAISEFPVPKTVRQLRRFLGMVNFYRRFLPRSAAIQAPLNALLAGNVKASHPVDISGDTLLAFDECKESLANAALLAHPDCQADLALVTDASDLAMGAVLQQYKNNVWEPLAFFSQKLSPSQQKYSPYDRELLAIYESIKYFRHMLEARHFVVFTDHKPLSYAFSEKKANCSPRQYRHLDYISQFTTDIRHISGKDNVVADPLSRVDELQVAVDLDVLASSQASDMELTRLLEGESSLRLKRLRVPNSRTELYCDVSTPTPRPFVTKDLRRQLFDSLHNLSHPGANATAKLVAERFVWPGMRRDCRQWSRQCQACQRAKIHRHVSSPLGTFDLPRARFAFIHVDIIGPLPVSQGYRYCLTAVDRFTRWPEVTPMADMTAETVGKALISWISRFGCPTDIVTDRGRQFESSLFQYLGKFIGFKHRRTTAYHPACNGLVERFHRQLKAAIMCHADCNWVDTLPLVLLGIRSAFKDDLQSSSAELVYGEPLRLPGEFFQATAPDSTDISDFNYRLRQFAAKLQPTPAARHNDDNKIFVHKDLTSSSHVFLRDDALRGALQPPYTGPYEVLERGEKTFKIQVKGKSVTVSIDRLKPAYILINPSPDSTPTLTSNSYPSSLPNPVPPEQRAPAQGDVRRTRSGRTVRFPDFYRP

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01009142    KMQ88359.1    LBMM01012479    KMQ86204.1    LBMM01013103    KMQ85815.1    + More
LBMM01013040    KMQ85849.1    LBMM01012030    KMQ86466.1    GEGO01003687    JAR91717.1    AAGJ04130731    KL367492    KFD69854.1    GBXI01017046    JAC97245.1    GBXI01015889    JAC98402.1    GBXI01003773    JAD10519.1    LBMM01012134    KMQ86388.1    KL363241    KFD51254.1    KL367552    KFD64647.1    AAGJ04001742    GEGO01001281    JAR94123.1    GFDL01003994    JAV31051.1    GEGO01004484    JAR90920.1    KQ973093    EFA13472.2    GEGO01000286    JAR95118.1    MRZV01001828    PIK35719.1    EF426679    ABP48077.1    GGLE01001814    MBY05940.1    LBMM01012160    KMQ86374.1    GFPF01012375    MAA23521.1    GEGO01004649    JAR90755.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    LN877232    CTR11708.1    GACK01008900    JAA56134.1    KL367655    KFD60653.1    CABG01000050    CAZ37786.2    BK004070    DAA04500.1    GEGO01004475    JAR90929.1    BK004066    DAA04495.1    IAAA01040175    LAA10459.1    LBMM01012633    KMQ86092.1    KQ971355    EFA07205.2    LBMM01001181    KMQ96765.1    GGFK01003401    MBW36722.1    GEDV01001796    JAP86761.1    GGFK01003442    MBW36763.1    GEGO01003506    JAR91898.1    ABLF02030693    ABLF02030697    GGLE01003443    MBY07569.1    AAGJ04112098    BN000802    CAJ00250.1    DF142933    GAA49140.1    GDKW01003376    JAI53219.1    GDHF01001116    JAI51198.1    IAAA01033850    LAA08869.1    KL367544    KFD65142.1    GDHF01014424    JAI37890.1    JYDT01000067    KRY86703.1    KL367664    KFD60497.1    KL367778    KFD59660.1    GDHF01021808    JAI30506.1    JYDR01000002    KRY79251.1    AY013565    AAK07486.1    AAGJ04172791    KL367543    KFD65158.1    AY013563    AAK07485.1    LBMM01012567    KMQ86146.1    AY013569    AAK07487.1    GBHO01015475    JAG28129.1    CABG01000001    CCD58591.1    KL367519    KFD67051.1    AAGJ04000250    GBYB01009311    JAG79078.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    JWZT01004124    KII64665.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JYDO01000387    KRZ65366.1    QPMK01000035    RDD64024.1    JYDJ01000353    KRX36608.1    KZ149973    PZC76007.1    FN356213    CAX83702.1    AAZX01006801    AAZX01023483    NIVC01003188    PAA52757.1    BN000785    CAJ00226.1    LBMM01012451    KMQ86215.1    JYDI01000020    KRY58560.1    KL363373    KFD46409.1    FN356212    CAX83701.1    KRY58561.1    AAZX01009606    KL367479    KFD72009.1    ABLF02040931    ABLF02040938   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF02709   Glyco_transf_7C
PF13733   Glyco_transf_7N
PF00013   KH_1
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034132   RP_Saci-like       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR013032   EGF-like_CS       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR027791   Galactosyl_T_C       
IPR036612   KH_dom_type_1_sf       
IPR003859   Galactosyl_T       
IPR004087   KH_dom       
IPR004088   KH_dom_type_1       
IPR027995   Galactosyl_T_N       
IPR029044   Nucleotide-diphossugar_trans       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF54791   SSF54791       
SSF53448   SSF53448       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=1.70424e-73,     Score=706

Ontologies

Topology

Length:
1203
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00476
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1203
 
 

Population Genetic Test Statistics

Pi
0.191387
Theta
0.208103
Tajima's D
0
CLR
0.198338
CSRT
0.530973451327434
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号