SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13382
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.778 Nuclear   Reliability : 1.447
 

Sequence

CDS
ATGTTTGAAGAGCAACAACTTAAGAAAATTGCAAATAGTTACTCAAAGCAGGAATCCAGGATTTTCTACAAGCAAGTGAATAGCGGAAAGAAGGAATTTAAACCAAGAACCTCAGCCTGTAGAAATAAAGATGGCCAACTGCTTAATGACAGAACAGAAGTCATTAAAAGGTGGGCAGAACACTTCCAAGAGCTACTAAACAAACCATCAGTTGCTACTCATATCGATGAAGTCGAAGCTCCACTTAATCATCAGTGGCTAGAAGTGTCCCAACCGTCTCTGGAAGACACGAGAGCTGCCAGCCAAAAACTCAAAAACAATAAAGCTCCAGGAAACGACAACATCCAGAGTGAACTGCTGAAATACGCTGGGTCCCAGTTTGAAGAGGAATTCCATAAACTAGTACTGCAGATATGGAATTCTGAAGTTATGCCTGAGGAATGGAACACAGCGGTTATTTGTCCTCTCCACAAGAAGGGCGATGTTCTCGACTGTCAGAACTATCGAGGCATTTCACTCCTCAATACAGCATATAAGATATTTGCGAACGTTCTCTTTGGCAAATTAAAACCTTTCGTGGAGCGTAGACTAGGAGAATATCAGTGTGGTTTCCGACCTGGCAGATCAACCATCGACCAAATCTTCTCCCTACGACAAATACTTGAAAAAACTCTTGAATTTAATGCTGACACGTATCACCTTTTTATTGATTTTAAAGCTGCCTACGACAACATAAGCCGTGATTTCCTATACCAGGCTATGCATGAGATTGGCGTACCACCGAAGCTTATATCTTTAACAAGGATGACACTGGTTGCATCGCAAAGCATTGTTAAGATCCAAACAGACCTATCGGATCCTTTTAGAACCCATGATGGACTAAGGCAGGGTGATGCCCTCTCCTGCCTTCTTTTCAATGTTGCACTCGATAAGTGTATCCGTGACTCAGCAATAGAGACGACGGGCAATATATATTACAAATCCGCTCAAGTACTGGGATATGCGGATGATATTGACGTCATTGGCAGATCAGCTCTCGCAGTAGAAAGTGCGTACCTTGCTCTCGAGGCCTCGTCTCTCGAAGCCGGTCTCCAAGTAAACGCAGACAAAACTAAATTCCTGAGGGTGTCGAGGGACTTACGTGAGGACACAGCGCATAAAAATATTGGCCAGCATACTTTTGGATCTGTGAATGAATTTGTATATCTTGGTTCTCTGATAACGAATAATAATAATATAACAGCAGAAATAGTTAAGAGAATACTGTCGGCGAATAAATGCTACTTCGGCCTGCTTAAATATTTCTGTTCCAAAATTCTGTCACGAAATATCAAAATTCTTTTATACAAGACCCTACTGAGACCCATTCTTATTTATGGCTCAGAGACATGGGTACTCAGCAAAAAAGATGAGAACCGTCTACTTGTGTTCGAGCGTAAGATTCTAAGACGGATATTCGGTGCTGTGCGGGAAAACCAGATATGGAGGACGCGCTATAACCACGAGTTGTATGATGTTTACAAAGATCCTAACATCATAACAACTATAAAGATTGGACGCCTACGATGGGCAGGACATGTGGTTCGAATGGAGAGTACCAGAATGCCAAGACAATTGCTCTATGGCAAACCAGAGGGCCGCAGAAGTCGTGGCAGACCCAAACTTCGATGGTTGGATGGCGTGGAGCGCGACCTCAAAAATATCGGCGTCAAGAACTGGAAGGAGAAAGCCCTGAACAGAGCAGTCTGGAGAGACATACTGGACCAGGCTAAGGCCCACCCTGGGCTGTAA
Protein
MFEEQQLKKIANSYSKQESRIFYKQVNSGKKEFKPRTSACRNKDGQLLNDRTEVIKRWAEHFQELLNKPSVATHIDEVEAPLNHQWLEVSQPSLEDTRAASQKLKNNKAPGNDNIQSELLKYAGSQFEEEFHKLVLQIWNSEVMPEEWNTAVICPLHKKGDVLDCQNYRGISLLNTAYKIFANVLFGKLKPFVERRLGEYQCGFRPGRSTIDQIFSLRQILEKTLEFNADTYHLFIDFKAAYDNISRDFLYQAMHEIGVPPKLISLTRMTLVASQSIVKIQTDLSDPFRTHDGLRQGDALSCLLFNVALDKCIRDSAIETTGNIYYKSAQVLGYADDIDVIGRSALAVESAYLALEASSLEAGLQVNADKTKFLRVSRDLREDTAHKNIGQHTFGSVNEFVYLGSLITNNNNITAEIVKRILSANKCYFGLLKYFCSKILSRNIKILLYKTLLRPILIYGSETWVLSKKDENRLLVFERKILRRIFGAVRENQIWRTRYNHELYDVYKDPNIITTIKIGRLRWAGHVVRMESTRMPRQLLYGKPEGRRSRGRPKLRWLDGVERDLKNIGVKNWKEKALNRAVWRDILDQAKAHPGL

Summary

EMBL
FJ265555    ADI61823.1    PYGN01000613    PSN43351.1    PYGN01000119    PSN53667.1    + More
GBBI01004263    JAC14449.1    GBBI01004261    JAC14451.1    GBBI01004262    JAC14450.1    PYGN01000254    PSN50032.1    IAAA01017079    LAA06070.1    GGFL01003846    MBW68024.1    GBRD01011073    JAG54751.1    GGFL01003845    MBW68023.1    GDAI01000742    JAI16861.1    GBRD01000202    JAG65619.1    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    GGFK01005184    MBW38505.1    GGFK01003613    MBW36934.1    GGFK01001798    MBW35119.1    GGFK01001949    MBW35270.1    QOUI01000020    RCK67885.1    KU311054    ALX81665.1    CH902619    KPU76535.1    GGFK01003183    MBW36504.1    CH902653    KPU74858.1    CH902657    KPU75308.1    CH904714    KPU81814.1    CH902626    KPU79149.1    CH902621    KPU81727.1    AJVK01001578    GAPW01000199    JAC13399.1    LBMM01005351    KMQ91586.1    GECL01001585    JAP04539.1    GALA01001775    JAA93077.1    GDHC01021627    JAP97001.1    GBBI01004198    JAC14514.1    QOIP01000009    RLU18885.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    CH902628    KPU75346.1    PYGN01000372    PSN47498.1    CH902714    KPU81861.1    CH902666    KPU74610.1    CH902618    KPU79125.1    CH902633    KPU74667.1    CH902630    KPU77522.1    CH902622    KPU75266.1    KPU77326.1    CH902623    KPU72899.1    CH902627    KPU74872.1    GBBI01004199    JAC14513.1    PYGN01000287    PSN49259.1    GAPW01000120    JAC13478.1    GAPW01000107    JAC13491.1    GBGD01000331    JAC88558.1    PYGN01000629    PSN43121.1    CH963259    KRF97428.1    CH902961    KPU72636.1    CH905131    KPU81852.1    UZAG01001147    VDO10529.1    GGMR01014652    MBY27271.1    GBHO01037470    JAG06134.1    PYGN01003402    PSN29545.1    GECL01002632    JAP03492.1    GBRD01017846    JAG47981.1    PYGN01000451    PSN46127.1    PYGN01000064    PSN55609.1    GGFJ01005240    MBW54381.1    NEVH01016288    PNF26362.1    PYGN01000203    PSN51319.1    PYGN01000020    PSN57453.1    HE799691    CCH14900.1    PYGN01000510    PSN45119.1    PYGN01000324    PSN48495.1    AZNE01000717    KID80942.1    PYGN01000047    PSN56294.1    PYGN01000219    PSN50892.1    PYGN01001382    PSN35227.1    PYGN01000070    PSN55417.1    GGMR01006433    MBY19052.1    PYGN01001004    PSN38555.1    PYGN01000502    PSN45243.1    ABLF02039015    PYGN01001494    PSN34463.1    ABLF02066124    GGMR01000126    MBY12745.1    GGMR01020071    MBY32690.1    GGMR01010991    MBY23610.1    ABLF02019047    ABLF02019049    GEHC01000890    JAV46755.1    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    PYGN01000212    PSN51056.1    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    GAPW01000151    JAC13447.1    PYGN01000107    PSN54137.1    GGMR01016675    MBY29294.1    ABLF02018097    ABLF02043469    ABLF02056908    ABLF02018925    ABLF02003877    ABLF02042991    AJWK01020943    ABLF02027703    ABLF02061609    GEZM01048836    JAV76363.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF13359   DDE_Tnp_4
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027806   HARBI1_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00172926,     Score=100

Ontologies

Topology

Length:
596
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0317099999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00215
outside
1  -  596
 
 

Population Genetic Test Statistics

Pi
8.793408
Theta
13.183642
Tajima's D
-0.882737
CLR
18.271027
CSRT
0.156042197890105
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号