SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13380
Annotation
reverse_transcriptase_[Lasius_niger]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
RNA-directed DNA polymerase from mobile element jockey      
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.531
 

Sequence

CDS
ATGTTCTCGTTGCGCATCGCTACCTGGAATATCAATGGATTGGCGCCAAATAAACAGGAGCTAGAAATTTTGCTCAAGCTTAATAAAATAGACATTGCGCTAATATCAGAAACTCATCTTAATGACAATAGAACAATTTTGATAGATAACTATAGTGTATATAACACAAATCATCCTAATGGAACTTCACATGGAGGAACCGCCGTTCTTATTAAAAATAACATAAGGCATAATGTACACAGTGCTTTTCGAGAGGAATGGCTTCAAGCTACTACTATAACTATAAACGAAAAGTTTGGGCCTATTAACATCAGTGCTATCTACTGTCCACCAAAACACAATCCTAAGCAAGATATGTTTAATAAATTCTTCAACACTTTGGGCAATAAATTTATAAGCGGAGGTGATTGGAACTGCAAGAATACATTCTGGGGATCACTGTTGACAACTACTAAGGGACGTGAACTGAAAAAAAGTGCTGATGATTGCAAGCTAACAATCCTTGGAACAGGTGAACCTACCTACTGGCCAACAGATACAAATAGACTTCCAGATCTGGTGGACTTTTTTATAATAAAGGGTCTTTCATATGTATATTTTGAAGTTGAGTCATCACTTGATTCTGTGTCGGATCACACTCCTGTCATAGCAACATTTAGCATCTCACCTATACAAAAAGAACAAAAAGAAGTACTATATAATTATAAAACAGACTGGAACTCATTCAGCGATTATCTAGAGGAAGAAATTAAACTTAGTGTTAAACTTAAAACAGAAGAAGATATAGATGAGGCAACATTTTATATCACAAACCTCATTCAAGTGGCTGCGTGGCATTCCACTCCAAAATTAAGCGATCATACTGTTAGTAATAATATACCTATGGAAATACGCCACAAACTTCAAGTAAAGAGAAAGCTAAGAAGGCAACTCCACATGACAAGATCCGATATAGACAGAAAAGAATTTAATAAAATCTCAAGAGAACTAAAAGAACTAATCAATGAATCTGTCAACTCAGCATTTCATCATAAAATATCAGGGCTCTCAGCATACAAGAAGGACAATTATTCTTTATGGAAAATCACCAAAAACTTCAAAAAACCTAAAAGCCATATTCCACCAATGAGGAAATCGCCAACCGACCCTTGGGCCAAGAGTACAACTGAAAAAGCTGAGCTATTTGCAAATTACTTGTATGAAATATTTACCCCTAACCTATCACCAATGGAGGACTATGAAAAAGAAGTTGATGTCATGATTAATAGTGACCAGCAGCTATCCCTGCCACTCAAATCCGTCACCCCCAGGGAACTTACGCAATGTATACAGTCTCTTAAAAATAAAAAAGCTCCTGGTTTTGATTTAATAACTGGTGAGGTACTTAAAAAATTGCCCAAAAAAGTAATAATATTTTTAACAATGTTATTCAATGCTATCCTCAGAGTACATTATTACCCAAAACTCTGGCAAATAGCACAAGTCTGCATGGTTATAAAGCCTGGAAAACCAGCGTCAGATCCAAGTTCATATAGGCCCATAAGTCTTCTACCTGTGTTGTCTAAGGTATTTGAAACGGTATTTCTAAAAAGACTGAAGCCGCTTCTTGACCAGGAAAAGATTATACCGGATCATCAGTTTGGATTTCGGGCGAAGCATTCTACTGTCGAACAAGTACACAGAGTAGTTCATAAAATTCGACAATCCTTAGAAAAGAAGGAATACTGTTCTGCGGCATTTATTGACATCAAGCAAGCTTTCGATAAAGTCTGGCATAAGGGATTACTATATAAATTGAAAACCCTCCTACCGAATTCTTTTTTCATGCTCCTGAGATCCTACTTAAAACACAGAAAATTCCAAGTCAAATTTGGAGAGGACTGTTCGAAGCTGTATAATATTAACGCCTCCGTACCCCAGGGATCAGTGCTTGGTCCGGTCCTGTTTTCTATCTATACTGCAGACCTGCCTCAATCCCAAGATGTTGTAACTGCGACTTACGCTGACGATACAGCTTGTCTGGCAAGTGACATAGATCCACATAATGCATCATTACAACTACAAGTACAGCTTGACAAAGTGGATGCTTGGCTGCAGAGATGGCGATTAAAACCTAGTGTAACTAAGTCAACGCAGGTAACATTCACCCTTCGGAAAGGTGTCTGTGACCCTGTTTACATGGAAGGTAAAGCTTTACCAAATGCCGACTCTGTGAAATACTTGGGATTACACCTCGACAGAAGATTAACCTGGGCGAACCATATAAAAGCAAAAAAACGAGAAGCGAACTTGCAATTTCTCTCTTTGAATTGGTTACTGGGACGCCGGTCTCCACTGTCACTAAGTAACAAACTCCTGGTCTACAAAGCGATTATAAAACCTGTCTGGACTTATGGAATAGAACTGTGGGGTTCCGCTAGCAACTCGAATATCGAGATCTTACAGAGATTCCAGAACATTGCTCTTAGAACTATCTCAAACGCGCATTGGTTTGTAAGAAATAGTGAGATTCACGAATACTTAGAAATGCCGACTGTTCGAGAGGAAGTCAACAAGAACAGCAAGAGATATAAGGAAAGACTAAATGAGCACTCAAATGAATTGGCAAGGTGCCTGCTAGACACAACTGGAGATGTGAAACGTTTAAAAAGATGGCAAATTTTAGACTTAGACCAAAGATACTAA
Protein
MFSLRIATWNINGLAPNKQELEILLKLNKIDIALISETHLNDNRTILIDNYSVYNTNHPNGTSHGGTAVLIKNNIRHNVHSAFREEWLQATTITINEKFGPINISAIYCPPKHNPKQDMFNKFFNTLGNKFISGGDWNCKNTFWGSLLTTTKGRELKKSADDCKLTILGTGEPTYWPTDTNRLPDLVDFFIIKGLSYVYFEVESSLDSVSDHTPVIATFSISPIQKEQKEVLYNYKTDWNSFSDYLEEEIKLSVKLKTEEDIDEATFYITNLIQVAAWHSTPKLSDHTVSNNIPMEIRHKLQVKRKLRRQLHMTRSDIDRKEFNKISRELKELINESVNSAFHHKISGLSAYKKDNYSLWKITKNFKKPKSHIPPMRKSPTDPWAKSTTEKAELFANYLYEIFTPNLSPMEDYEKEVDVMINSDQQLSLPLKSVTPRELTQCIQSLKNKKAPGFDLITGEVLKKLPKKVIIFLTMLFNAILRVHYYPKLWQIAQVCMVIKPGKPASDPSSYRPISLLPVLSKVFETVFLKRLKPLLDQEKIIPDHQFGFRAKHSTVEQVHRVVHKIRQSLEKKEYCSAAFIDIKQAFDKVWHKGLLYKLKTLLPNSFFMLLRSYLKHRKFQVKFGEDCSKLYNINASVPQGSVLGPVLFSIYTADLPQSQDVVTATYADDTACLASDIDPHNASLQLQVQLDKVDAWLQRWRLKPSVTKSTQVTFTLRKGVCDPVYMEGKALPNADSVKYLGLHLDRRLTWANHIKAKKREANLQFLSLNWLLGRRSPLSLSNKLLVYKAIIKPVWTYGIELWGSASNSNIEILQRFQNIALRTISNAHWFVRNSEIHEYLEMPTVREEVNKNSKRYKERLNEHSNELARCLLDTTGDVKRLKRWQILDLDQRY

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
NWSH01000032    PCG80496.1    NEVH01007402    PNF35856.1    NWSH01007753    PCG62823.1    + More
NEVH01016340    PNF25410.1    NEVH01021925    PNF19341.1    NEVH01015305    PNF27092.1    NEVH01006736    PNF36716.1    NEVH01016302    PNF25823.1    NEVH01001347    PNF42959.1    NEVH01008277    PNF34262.1    NEVH01023979    PNF17579.1    NEVH01020940    PNF20481.1    NEVH01026386    PNF14434.1    NEVH01005295    PNF38784.1    NEVH01019963    PNF22185.1    ABLF02041861    GEZM01084969    JAV60363.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GEZM01053022    JAV74219.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    LBMM01013518    KMQ85605.1    GFTR01008261    JAW08165.1    GEDC01000337    JAS36961.1    KU543673    AMS38352.1    GFTR01008251    JAW08175.1    KU543687    AMS38379.1    GFTR01008257    JAW08169.1    GGMR01006491    MBY19110.1    GGMR01000676    MBY13295.1    GFTR01008256    JAW08170.1    DNOY01000259    HBE18313.1    AY508487    AAS13459.1    X17551    CAA35587.1    GFTR01008269    JAW08157.1    GGMR01000226    MBY12845.1    KU543685    AMS38375.1    GFTR01008254    JAW08172.1    GBGD01000389    JAC88500.1    GFTR01008151    JAW08275.1    GGMR01012443    MBY25062.1    AY047531    AAK77263.1    GGMR01003407    MBY16026.1    NEVH01020963    PNF20308.1    GFXV01000908    MBW12713.1    ABLF02016613    M17214    AAA28508.1    CP012527    ALC48130.1    GGMR01016905    MBY29524.1    GAKP01017773    JAC41179.1    GFTR01008271    JAW08155.1    GGMR01003864    MBY16483.1    GECL01003538    JAP02586.1    LBMM01012041    KMQ86458.1    GBBI01003747    JAC14965.1    GGMR01006408    MBY19027.1    GFTR01008260    JAW08166.1    GFTR01008169    JAW08257.1    GFXV01002840    MBW14645.1    NEVH01006721    PNF37225.1    GFTR01008246    JAW08180.1    GGMR01005022    MBY17641.1    GGMR01012676    MBY25295.1    GGMR01012305    MBY24924.1    LBMM01012078    KMQ86419.1    GGMS01017365    MBY86568.1    GGMR01012283    MBY24902.1    GGMR01016296    MBY28915.1    GGMS01006655    MBY75858.1    GBHO01008295    JAG35309.1    GGMR01011511    MBY24130.1    GDHC01020244    JAP98384.1    GFTR01007929    JAW08497.1    ABLF02017755    ABLF02044739    ABLF02063495    ABLF02065698    ABLF02066197    GGMR01020516    MBY33135.1    LBMM01006314    KMQ90710.1    GGMS01006359    MBY75562.1    ABLF02034460    GFTR01007997    JAW08429.1    LBMM01015125    KMQ84919.1    GFDF01007661    JAV06423.1    GBBI01003810    JAC14902.1    GEZM01021881    JAV88842.1    GGMR01013409    MBY26028.1    AF237761    AAF81411.1    GEDC01029594    JAS07704.1    ABLF02025048    ABLF02063033    ABLF02021819    ABLF02021820    ABLF02055326    M22874    M38643    ABLF02014118    ABLF02014121    ABLF02054790    ABLF02040174    ABLF02040183    ABLF02055266    AY060438    AAL25477.1    GGMS01002786    MBY71989.1    M38437    GDHC01018248    JAQ00381.1    GFTR01007904    JAW08522.1    GEZM01084970    JAV60359.1    GGMR01000857    MBY13476.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
894
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11729
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00122
outside
1  -  894
 
 

Population Genetic Test Statistics

Pi
19.490342
Theta
25.407928
Tajima's D
-1.315929
CLR
22.900073
CSRT
0.0848457577121144
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号