SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13373
Annotation
unnamed_protein_product_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.769
 

Sequence

CDS
ATGGAGTTATCTGCTGCAAGTCTCTTAACACAGCTTATGATACGTGTCTCGACTCAATTGTTGTCCCATATTACCATAAAGAAACACATATGCTGGTCAGACAGTACCATTGTCCTAGCATGGCTAAACACACCTCCTCATAGACTTCAGGTATTTGAAGCTAACAGGGTTGCCAAGATAACATCCAATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCAGCTCATGATCTTTGGTGGTCTCCTAGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCATTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATATAGCAGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGCGCTCTGGTCCCTTGACAGTTGGAGAACGTAGAGATGCTCTGTTATTCTGGGTTCGCTCTGTTCAACACAATGAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACTATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGCCCACTAGTTGATCTCATCATAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTGACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCGTGTACAAATGCATTAGATGTTTCCGATATCGCGCTCAGGCCAGAGCTCCGTTGATGGCTGATTTGCCCGCAGACAGGGTCACACCCCGGCCACTCATCCAAGCTCTCTCTCAGCGTTTTTGGACTCTGTGGACCAAATCCTATCTCCATACCCTCCAAACCCGCTCCAAATGGCTTTCCACATCCTCACCTCCTCAAGTTGGAGAGCTCGTCCTCATCAAAGAGGACAATCAGCCCCCGCTGCAATGGAAACTTGGAAGGATTATCCGCACGTTACCCGGCAAGGATGGAGTGATCAGAGTCGTGGATTTGGACACGAAGCATGGAAGTCTGCGGAGACCTGTGTTCAAGTTAGCCAGGTTGCCGCTGGATTCAGCACATGAAGAAGTTCAGCCCCGGCCGCCCCAGGATGTGTGA
Protein
MELSAASLLTQLMIRVSTQLLSHITIKKHICWSDSTIVLAWLNTPPHRLQVFEANRVAKITSNPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPSWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHIAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRRSGPLTVGERRDALLFWVRSVQHNEFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYYAQHPLVLPSSSPLVDLIIDHYHRINCHPGADTLHAILRQQFWILSARRVIRHRVYKCIRCFRYRAQARAPLMADLPADRVTPRPLIQALSQRFWTLWTKSYLHTLQTRSKWLSTSSPPQVGELVLIKEDNQPPLQWKLGRIIRTLPGKDGVIRVVDLDTKHGSLRRPVFKLARLPLDSAHEEVQPRPPQDV

Summary

EMBL
AB012906    BAA33576.1    AB012907    BAA33577.1    DS497760    EFA13221.1    + More
GEBQ01018232    JAT21745.1    GEBQ01015599    JAT24378.1    GECU01010337    JAS97369.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GECZ01006169    JAS63600.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GGMR01000737    MBY13356.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GBHO01021103    GBHO01021101    JAG22501.1    JAG22503.1    ABLF02052963    GBHO01004194    JAG39410.1    GALX01004947    JAB63519.1    GEBQ01005223    JAT34754.1    GBHO01004196    JAG39408.1    ABLF02008594    GEBQ01029803    JAT10174.1    GDHC01006469    JAQ12160.1    GBHO01003578    JAG40026.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    ABLF02006304    ABLF02036268    GBHO01019177    GBHO01003185    JAG24427.1    JAG40419.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GDHC01018560    JAQ00069.1    GDHC01006567    JAQ12062.1    GBHO01023090    JAG20514.1    ABLF02017373    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    MCIT02012214    PHT96336.1    ABLF02041863    GBHO01006408    JAG37196.1    GBRD01007977    JAG57844.1    GBHO01044316    JAF99287.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02035110    ABLF02067347    GGMR01017890    MBY30509.1    GGMR01015135    MBY27754.1    GALX01005107    JAB63359.1    ABLF02030854    MCIT02006707    PHT96417.1    KQ973442    KXZ75531.1    GGMR01002421    MBY15040.1    GBHO01038469    JAG05135.1    GGMR01013370    MBY25989.1    GBBI01004409    JAC14303.1    GBBI01004407    JAC14305.1    GDHC01011948    JAQ06681.1    GFTR01008874    JAW07552.1    LBMM01009964    KMQ87756.1    LBMM01012392    KMQ86241.1    GBHO01019080    JAG24524.1    GEZM01054765    JAV73413.1    QOIP01000009    RLU19130.1    GBHO01010487    GBHO01010485    JAG33117.1    JAG33119.1    GBHO01009080    JAG34524.1    LNIX01000063    OXA37199.1    GBHO01010489    GBHO01010484    JAG33115.1    JAG33120.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GEZM01072348    JAV65549.1    LBMM01009551    KMQ88039.1    ABLF02008636    ABLF02065931    ABLF02017056    JTDY01005490    KOB66948.1    GAIX01013989    JAA78571.1    GBHO01034064    JAG09540.1    LBMM01018894    KMQ83668.1    LNIX01000016    OXA46198.1    ABLF02008635    ABLF02023121    ABLF02065930    LNIX01000069    OXA36894.1    GBHO01033788    JAG09816.1    LNIX01000007    OXA51795.1    GEBQ01028569    JAT11408.1    LNIX01000002    OXA60848.1    GEBQ01015458    JAT24519.1    GBHO01027267    JAG16337.1    RLU18850.1    ABLF02028666    ABLF02066713    GGMS01016125    MBY85328.1    GEHC01000877    JAV46768.1    GBHO01045636    GBHO01045635    JAF97967.1    JAF97968.1    GEBQ01000825    JAT39152.1    GDHC01014057    JAQ04572.1    LBMM01012238    KMQ86334.1   
Pfam
PF05380   Peptidase_A17        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF00665   rve
PF03564   DUF1759
PF05585   DUF1758
PF00078   RVT_1
Interpro
IPR041588   Integrase_H2C2        + More
IPR008042   Retrotrans_Pao       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
434
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00846999999999999
Exp number, first 60 AAs:
0.00744
Total prob of N-in:
0.00139
outside
1  -  434
 
 

Population Genetic Test Statistics

Pi
15.656753
Theta
10.59589
Tajima's D
-1.001845
CLR
26.233807
CSRT
0.134493275336233
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号