SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13349
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.508
 

Sequence

CDS
ATGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCCTCGATGCCCCGGGTCGGCTCTCGGCACTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGGCGAGCCGCCGGTGCACTAGACACCGCCGTCGCCGCCGCCTGCGGCGCGACGAGCCCGTCGCGTTCGCGGAGGAGGAAGCTCGGCTGCACCGCGAATATCGCGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCGTGGGGGAGCCCATATAAATTGGTACGCGGCAAGTTGCGCCCGTGGGCCCCCTCTATGACTGAGCGTCTCCAGCCCCAGCAGCTGCGGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTATTGTCCCTCCCGCTATGGGCGGGCCGTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACCGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAGAGACACGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGGTATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTGGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGAGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGGGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGTTTTCCGGTCGTGCGTGGTGTTCCACAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGTCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGTCTGGGTCTCGACGTGGCGCTCAGTAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCAGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGCCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTTCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGTCGACTATCGGTGGCGCAGCGAGCTCCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGAGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAAGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGSRHSGRRQSPWWSPEIARLRAVSIRASRRCTRHRRRRRLRRDEPVAFAEEEARLHREYRAAKDALRLAIRRAKEQNMERLLEALEADPWGSPYKLVRGKLRPWAPSMTERLQPQQLRDIVSALFPQEREGIVPPAMGGPSDTVDGQAPAEVPRITEAELRVAVVKMTARDTVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVGHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARSVVCTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALVVGRIRSLGLDVALSKSEALWFHGPRRAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAVDYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    AB078935    BAC06462.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    AB078936    BAC06464.1    KQ460685    KPJ12887.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01002052    KMQ95336.1    LBMM01007036    KMQ90099.1    LBMM01002480    KMQ94776.1    LBMM01006657    KMQ90417.1    LBMM01008448    KMQ88867.1    LBMM01005948    KMQ91066.1    LBMM01012412    KMQ86235.1    LBMM01007425    KMQ89740.1    LBMM01015025    KMQ84953.1    LBMM01008278    KMQ89009.1    RSAL01003504    RVE40273.1    LBMM01003988    KMQ92922.1    LBMM01004505    KMQ92346.1    LBMM01015018    KMQ84954.1    LBMM01008422    KMQ88894.1    LBMM01004634    KMQ92224.1    LBMM01014122    KMQ85315.1    LBMM01005733    KMQ91252.1    LBMM01015565    KMQ84759.1    LBMM01005474    KMQ91485.1    GGMR01000779    MBY13398.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01005465    KMQ91492.1    GGMR01015159    MBY27778.1    LBMM01003245    KMQ93755.1    GFXV01002090    MBW13895.1    ABLF02011238    GGMR01006838    MBY19457.1    GGMR01004600    MBY17219.1    LBMM01005216    KMQ91703.1    ABLF02041886    LBMM01004262    KMQ92649.1    GGMR01011682    MBY24301.1    ABLF02034925    LBMM01004261    KMQ92650.1    ABLF02023257    GFXV01003903    MBW15708.1    GGMR01019493    MBY32112.1    KMQ94772.1    LBMM01015285    KMQ84870.1    ABLF02041557    KU543683    AMS38371.1    ABLF02004854    ABLF02041317    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GGMR01014195    MBY26814.1    ABLF02018808    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01012748    MBY25367.1    ABLF02059310    ABLF02013358    ABLF02013361    ABLF02054869    KQ971309    EEZ99146.1    LBMM01008445    KMQ88871.1    GGMR01015354    MBY27973.1    ABLF02007989    ABLF02011183    ABLF02041884    ABLF02014650    GGFL01001583    MBW65761.1    ABLF02004597    ABLF02041324    ABLF02018942    ABLF02041885    ABLF02010223    AB593327    BAK38648.1    ABLF02021100    GAKP01002292    JAC56660.1    GGFJ01001165    MBW50306.1    LBMM01008226    KMQ89040.1    GGFJ01001164    MBW50305.1    AB593321    BAK38639.1    AB593323    BAK38643.1    AB593325    BAK38646.1    GGFJ01001439    MBW50580.1    KQ972226    KYB24577.1    GGFJ01001727    MBW50868.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000327524,     Score=107

Ontologies

Topology

Length:
808
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0327800000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00093
outside
1  -  808
 
 

Population Genetic Test Statistics

Pi
118.890839
Theta
24.789619
Tajima's D
0.84154
CLR
0.369035
CSRT
0.628768561571921
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号