SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13345
Annotation
PREDICTED:_uncharacterized_protein_LOC106138993_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.522
 

Sequence

CDS
ATGCCTCCTAAGAAGAATAATGATAATGACGAAAGAGAAGACGTTGAGAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATGGAACAGAGATGGTGGCTTTGATCGATACAGGAAGTGACGCCAATCTTATTATAAAATCAGAATTTGAAAAAATTGAAAATAATATCCAACATTATGACAAGAATTCAGAAGCTCGTCTTACGGGTATTGCTAACAAAGAAGTACTTATCAAAGGTGTTTTTACTACTCAGCTACAGATTGATGATGCTGTTACGGATATCAAATTTTACATTGTGGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTTAAGTTTACAAGAAATGGTATTTTAATGGAGAAGATTCCACTTTGTGCTATTGTTGTTGAGAAGGACGAGGTCAAAGAAGACTACAAGAAATTAAAAAAAGGAGATTACAAGAAGTTAGAGAAAGAAGATTACAAGAAGTTAGAAAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAGAATACTGTACAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACCAAAGAAGATGGATAAAGAAATTAGAAGACAGAATTATAGGAGAGGTCGACTAAAAGTTGAAGATTGGGAATGGAGGAGGTCCGATACATACGACTAA
Protein
MPPKKNNDNDEREDVEKKNEEEKIPYKKVLLNGTEMVALIDTGSDANLIIKSEFEKIENNIQHYDKNSEARLTGIANKEVLIKGVFTTQLQIDDAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGILMEKIPLCAIVVEKDEVKEDYKKLKKGDYKKLEKEDYKKLEKEDCKKLVKVPYQNHLTQNRILYKEKNGSSFIAVPKKMDKEIRRQNYRRGRLKVEDWEWRRSDTYD

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
239
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0032
Exp number, first 60 AAs:
0.00161
Total prob of N-in:
0.15937
outside
1  -  239
 
 

Population Genetic Test Statistics

Pi
256.718031
Theta
136.074786
Tajima's D
2.648618
CLR
0.84226
CSRT
0.95955202239888
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号