SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13343
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.084 Mitochondrial   Reliability : 1.488
 

Sequence

CDS
ATGCACACGAGGTTGGCTGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGAAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCGTCGCGTGCGGTCCCTCTCGGATGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTAGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATCTGGGGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGTTTTCCGGTCGTGCGTGGTGTTCCGCAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTATAGGGAGTCTGCCCGTCTCGCCACGGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCGACGTGGCGCTCAGTAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCCGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGCGGCGTGTGTTTTGGTGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTCTCCTCGAAAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAAGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGATGACGAGGTGTCACCATTGTGGACACGACCTGGAAACGGCGGAGCATACGCTCGCTGTCTGCCCTGCGTGGGAGGTGCAGCGCCGTGTCCGGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGACTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MHTRLAEAGKLLERILAARIVRHLVGVGPDLSAKQYGFREGRSTVDAIRRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARSVVCTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDYRESARLATAGVALVVGRIRRLGLDVALSKSEALWFHGPRRAPPVDTHIVVGGVRIGAACVLVGTPPWELEAESLAADYRWRSELRARGVARLLESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPMTRCHHCGHDLETAEHTLAVCPAWEVQRRVRVAKIGPDLSLPGVVASMLGSDDSWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

Pfam
PF01421   Reprolysin        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR024079   MetalloPept_cat_dom_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001590   Peptidase_M12B       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=3.8372e-06,     Score=121

Ontologies

Topology

Length:
445
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.44748
Exp number, first 60 AAs:
0.0085
Total prob of N-in:
0.02715
outside
1  -  445
 
 

Population Genetic Test Statistics

Pi
30.300735
Theta
45.576865
Tajima's D
-1.137183
CLR
0.113956
CSRT
0.113944302784861
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号