SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13331
Annotation
PREDICTED:_uncharacterized_protein_LOC105841419_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.643
 

Sequence

CDS
ATGGAATCAGTAACAACGAGAGTGAATTTGTTGGGCAACCCGACTAACCATCGGCGCCACCCAGTATCCGGGCTGGATGGTGTGAAATTGGCAACCGAAGCTTCCCCTGAGGTAAATCGACAGGCCTCAGAAGGAGGAGATACTACTGTCGGTACTGCAGCTTCTAAAAGCGAGAAGACCTCTATACGATCGAGTCATCGTATTGGCGCTTGGAACGTCCGAGGTCTGCTGGAGGCGGGTAAGCTGACAATCGTGGAAAAGGAAATGGAATCTCATGACATCTCCATACTAGGCATCAGTGAAACTCACATGCGTGGTAATGGCCACTTCACCACTGCGACAGGGAACACCATGTACTTCTCAGGCTGTGAAGATTCAAGTTTGAGTGGAGTCGGAATCATATTGCCGCCACACTTAAACAAATATGTCCTCGGTTATAATCCGGTGTCTGATAGAATCCTGACAATGAAACTGAATACCAATCCATGTGTGCTGAATGTTATACAGATATACGCACCGACGGCACAAGCTCAGGATGAGTTAATTGTGGACTTCTATGGAAAACTGGAGGAAATACTGAATTCTATACCTAGTCGGGAAATTAAGATAATTCTTGGTGATTGGAATGCCAAAGTTGGCAGTACACTGGATGATAATCATATCAGGAGCACAGTTGGAAAATTTGGACTTGGCATTAGGAATGAACGGGGTGAAAAACTGATCGAGTTCTGCATTGAAAGAAATCTCAGTATTATGAACACTTACTTCCAACATCATCCAAGACGCTTATACACGTGGAGATCTCCAGGTGACAGGTACAGAAATCAAATCGACTACATCATTCTAGATGGCCGCTGGAGATCCTCAGTATCTAACGTGAAGACCTTTCCCGGCGCAGAGTGCGGCTCCGACCATAACCTGCTCGTAGCTAACTTCTCGCTGCGTTTAAAGGCGCCCAGACGTCAACCACCAAAACCCAATAGTTTGGATCCTTCCGAACAACCGATCTTCCGAGAGGCATTAGAGGCGATCTTGAAGGATTCTCCAACGCACATTCACGCTAACGCTGATACACAGTGGAAACACTTGAAAGGTCACATCAACGATGCGCTGGACCAGATCGCTAAAAAGAAAAAGCCAGAACCGAAGAAAAAATGCTGGATCTCCGATCATTCGTGGGAGCTTATTCAACGCAGGAAAGACTTAAAAACTAGCGGTTTGCAAAATGGTGCAAAGGTTAAATACTCCGAACTTAGCAGAGCTATTCGGGTCAGTTGTCGCCTTGACAAGAACCACTTTGTTGAGAAAAATCGTGCGTGCGAAGGTGATACAAAAGGGTGGGCACGACCCTCAGCAATGAGGAATACGACGCAAGGTGGAGGTAATTATACATACTTATATCATGTATATAAGTCTCAATTAAGGGAGCATTTCAGGGACTTTCACATTTGA
Protein
MESVTTRVNLLGNPTNHRRHPVSGLDGVKLATEASPEVNRQASEGGDTTVGTAASKSEKTSIRSSHRIGAWNVRGLLEAGKLTIVEKEMESHDISILGISETHMRGNGHFTTATGNTMYFSGCEDSSLSGVGIILPPHLNKYVLGYNPVSDRILTMKLNTNPCVLNVIQIYAPTAQAQDELIVDFYGKLEEILNSIPSREIKIILGDWNAKVGSTLDDNHIRSTVGKFGLGIRNERGEKLIEFCIERNLSIMNTYFQHHPRRLYTWRSPGDRYRNQIDYIILDGRWRSSVSNVKTFPGAECGSDHNLLVANFSLRLKAPRRQPPKPNSLDPSEQPIFREALEAILKDSPTHIHANADTQWKHLKGHINDALDQIAKKKKPEPKKKCWISDHSWELIQRRKDLKTSGLQNGAKVKYSELSRAIRVSCRLDKNHFVEKNRACEGDTKGWARPSAMRNTTQGGGNYTYLYHVYKSQLREHFRDFHI

Summary

EMBL
ODYU01006118    SOQ47682.1    FJ265553    ADI61821.1    KZ150025    PZC74827.1    + More
KZ150087    PZC73751.1    FJ265548    ADI61816.1    FJ265557    ADI61825.1    FJ265546    ADI61814.1    LBMM01000801    KMQ97461.1    FJ265559    ADI61827.1    GU815090    ADF18553.1    FJ265547    ADI61815.1    FJ265560    ADI61828.1    GGMR01007827    MBY20446.1    FJ265552    ADI61820.1    MRZV01001216    PIK39651.1    GBBM01003639    JAC31779.1    NCKU01004395    RWS06003.1    ABLF02027064    ABLF02027066    NEVH01016294    PNF26085.1    HACG01048879    CEK95744.1    HACG01048873    CEK95738.1    NEVH01000258    PNF43784.1    NEVH01002141    PNF42594.1    NEVH01007824    PNF35184.1    NEVH01018380    PNF23492.1    NEVH01021610    PNF19569.1    NEVH01025668    PNF15041.1    NEVH01021928    PNF19298.1    NEVH01021931    PNF19256.1    NEVH01015309    PNF27009.1    NEVH01013959    PNF28275.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01017452    PNF24293.1    NEVH01002684    PNF41704.1    NEVH01003750    PNF40091.1    NEVH01014359    PNF27813.1    PNF42599.1    NEVH01025135    PNF15828.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    PNF27789.1    NEVH01007402    PNF35815.1    NEVH01019064    PNF23230.1    NEVH01014358    PNF27914.1    NEVH01019971    PNF22037.1    NEVH01017570    PNF23798.1    NEVH01013275    PNF29009.1    NEVH01019075    PNF22955.1    NEVH01023985    PNF17546.1    AAGJ04003947   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
Interpro
IPR027124   Swc5/CFDP2        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
483
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0072
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00580
outside
1  -  483
 
 

Population Genetic Test Statistics

Pi
470.376017
Theta
228.468884
Tajima's D
4.015384
CLR
0
CSRT
0.998800059997
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号