SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13322
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.591
 

Sequence

CDS
ATGATATTTAAAACGTACACAAAATTCGGCGTCTTGTGTTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGGGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGTTTTCCGGTCGTGCGTGGTGTTCCGCAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCAGCGTGGCGCTCAATAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCCGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCCTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCTTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCGGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MIFKTYTKFGVLCSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARSVVCTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALVVGRIRRLGLSVALNKSEALWFHGPRRAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGGDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KZ150386    PZC71062.1    D85594    BAA19776.1    RSAL01000481    RVE41577.1    LBMM01024063    KMQ82623.1    LBMM01019839    KMQ83438.1    KQ460685    KPJ12887.1    LBMM01019838    KMQ83439.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01006671    KMQ90407.1    LBMM01005733    KMQ91252.1    LBMM01006725    KMQ90373.1    LBMM01008682    KMQ88705.1    LBMM01002052    KMQ95336.1    LBMM01007036    KMQ90099.1    LBMM01006063    KMQ90967.1    LBMM01005948    KMQ91066.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01003245    KMQ93755.1    LBMM01015018    KMQ84954.1    LBMM01014956    KMQ84982.1    LBMM01002480    KMQ94776.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01004505    KMQ92346.1    LBMM01007425    KMQ89740.1    LBMM01012412    KMQ86235.1    LBMM01005216    KMQ91703.1    LBMM01008278    KMQ89009.1    LBMM01005465    KMQ91492.1    KMQ94772.1    LBMM01021647    KMQ83033.1    LBMM01014122    KMQ85315.1    LBMM01013668    KMQ85535.1    LBMM01005474    KMQ91485.1    LBMM01005845    KMQ91162.1    LBMM01003575    KMQ93366.1    LBMM01004261    KMQ92650.1    LBMM01004262    KMQ92649.1    LBMM01006496    KMQ90570.1    GGMR01000779    MBY13398.1    ABLF02011238    GGMR01014195    MBY26814.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02005203    ABLF02041316    GFXV01002090    MBW13895.1    GGMR01015354    MBY27973.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01004600    MBY17219.1    QOIP01000031    RLU14697.1    GALX01004785    JAB63681.1    GGMR01012748    MBY25367.1    QOIP01000010    RLU18098.1    ABLF02041886    GGMR01015159    MBY27778.1    LBMM01015285    KMQ84870.1    ABLF02004597    ABLF02041324    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    ABLF02034925    GBXI01013438    JAD00854.1    AB593321    BAK38639.1    ABLF02004854    ABLF02041317    KQ971309    EEZ99146.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01006838    MBY19457.1    KQ972691    KXZ75807.1    KXZ75806.1    APGK01005465    KB736249    ENN83233.1    KQ972544    KXZ75869.1    LBMM01004697    KMQ92167.1    AB593326    BAK38647.1    KU543683    AMS38371.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF07776   zf-AD
PF00096   zf-C2H2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00883722,     Score=93

Ontologies

Topology

Length:
530
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.40404
Exp number, first 60 AAs:
0.16296
Total prob of N-in:
0.01918
outside
1  -  530
 
 

Population Genetic Test Statistics

Pi
28.739777
Theta
42.509176
Tajima's D
1.520098
CLR
0.526855
CSRT
0.790460476976151
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号