SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13299
Pre Gene Modal
BGIBMGA005984
Annotation
PREDICTED:_uncharacterized_protein_LOC106140950?_partial_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.124
 

Sequence

CDS
ATGATCATGGTGAACACTCGAAGTGATAACCGTGCTAGCCGAAATCGCAGGGATGATGATGCAACGGACCCGTCGTCTGTCCGCGTCCCGCGATCGGTCTCCCCGAGCGCGTCCGCCGCCCAAGAAAATGGAGCCGGTGACGCCTCGCGCATAATCTACGAGTCCTTTCGAGAAGCATCTACGAGCGCGTCTCCCGCCTGCGAAATCGGCGCTGCTGACGCCTCGCGCTCCAATCACCACAACCGATCCGGCGACAGCCACGTGGCCCCCGCCGAAGCCACCTTCTCCAGCGAGCACGTGTCAACAATAGTAGAGGCACTACAGCGGAGCCAAACAGAGGTTTTGAAATCATTATTTGAAACGATACGGCACAATACATCAACACCAGTGCCCGCATCACATGCACACGCGAACTTCGCCCGATGTACCGCGCGCTTTAGTGGGACTGCAGGTGAGTCGCTTGATGCCTTCCTGGATGCGGCCGAGGCCTATCGCGACTGCTCCGACATCTCGGATGAGAACGCCGTCCGGGGATTGTCGATGTTACTGATAACAGTGATAATGCCGATCGAGCTCGTATTGATCGCCCAGGTTCTTCTCGAGAAAAGAACCACAATATCACTGCATGCAACACGAAATGCATAA
Protein
MIMVNTRSDNRASRNRRDDDATDPSSVRVPRSVSPSASAAQENGAGDASRIIYESFREASTSASPACEIGAADASRSNHHNRSGDSHVAPAEATFSSEHVSTIVEALQRSQTEVLKSLFETIRHNTSTPVPASHAHANFARCTARFSGTAGESLDAFLDAAEAYRDCSDISDENAVRGLSMLLITVIMPIELVLIAQVLLEKRTTISLHATRNA

Summary

ProteinModelPortal

Ontologies

GO

Topology

Length:
214
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
20.15622
Exp number, first 60 AAs:
0
Total prob of N-in:
0.73171
inside
1  -  177
TMhelix
178  -  200
outside
201  -  214
 
 

Population Genetic Test Statistics

Pi
269.829228
Theta
216.128014
Tajima's D
0.793889
CLR
0.015449
CSRT
0.602469876506175
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号