SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13268
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.505
 

Sequence

CDS
ATGGCTACCAACTACCTTATCAATGTGCCGAAACTAAAAGGACGCGATAATTATTCAGAGTGGTGTTTCGCTGCAGAAAATTTTTTAGTACTCGAAGGCATGAAGCATTGCATCAAGCCAGAACCGGGGAAAGAAATAGCAAGCGCGGATGACGAAAAAACTAAAGCCAAATTGATCATGACCATCGACCCGTCGTTGTACGTACATGTCAAAACCGTTAAATCGTCGAAAGAATTGTGGGATAAACTAAGGCAATTATTCGATGATAGTGGCTTTTCACGAAGAATTAGTCTATTGAGAAATTTAATTTCAATCCGGCGAGATAATTGCAGTTCGATGACGTCATACGTGACGCAGATAATCGATACAGCGCAGAAATTAAGTGGAACGGGATTTGAAATAAACGAGGAATGGGTGGGATCATTGCTGTTGGCGGGGCTGCCAGAAAAGTTTGCCCCAATGATCATGGCAATTGAACATTCCGGGATTGCCATAAACTCTGATGTAATTAAAACAAAATTACTTGATATGAGTTCCGAGATCGGTGACCATGATCCGGAAGTTGCACTATGGTCGAAACCAAAAACGAGGGTAGATCAAAATTTCAATACAAAAGGCGAGAAACGAACATCAAATACGTCAAATGTAAAAAAAAAGGTTATAAAATGCTATAAATGTAAGCAAAATGGTCATTATAAAAATCAGTGTCCGAGTTTAGAAGCCGAAAAAAGAAAACAATCCAACGCCTTTAGTGCTATTTTCTTAAGTGGAAATTTCAACTGCGATAGTTGGTACATAGATAGCGGGGCCAGCAAACACATGACAGCAAAGAAAGAATACGTTGAGAGTCCATCATTTGAACATGAAATTAAAGAAATAATTGTTGCGAACAAAACATCCGTCCCGGTAGTGTGTTCTGGTGATGTAAACATAATCACAGTTGTGAATGGTGTAGAATATGACATCACAGTTTCAAATGTATTGTGCATACCGAGTTTAACAACAAACTTGCTTTCAGTGAGTCAGTTAATTGAGAATGGCAATAAGGTAATCTTTAAAGAGAAATTTTGCTATATTTACAATCAACAGAGAACTCTAGTTGGAAAGGCAGAATTAGTAGATGGTGTGTACAGATTATATACTAAGAAATCAGAACAGTTATTCGCAGCCACAGCTAAGGTGTCGAGTGAAACTTGGCATCGACGATTAGGGCATATCAACAGTACCAGCTTGAACAAAATGAAGAATGGAGCTACGACAGGTATTTCATACACAAATAAAGCTGATGTTGACAAATCTAAGTGTACTGTTTGCTGTAAGGGGAAGCAGGCTAGACTACCTTTTCAGCCTAGTTCAACTAGCACCCAAGATATTTTAGAATTGATACACTCAGATGTGTGTGGTCCGATGGAAAATGTGTCTATTGGAGGTTCCAGATACTATGTCTTATTTGTGGATGACTACAGCAGAATGGTTTTTGTATACTTCATGAAAACAAAGTCAGAGGTATTTAAGTTTTTCAAAGAATTCCAGTCACTTGTAGAAAAACAGACAGATCGGAAAATTAAAATTCTAAGAACAGACAATGGCGGTGAGTACTGCAGTCAAGACTTTGAAAGATATCTAAAACAACACGGAATAATTCACCAGAAAAGTAATGCTTACACACCACAGCAAAATGGTGTGTGTGAAAGGATGAATAGGTCATTAGTTGAAAAGGCTAGATGTCTAATTTTTGATGCTGGTTTACATAAAAAGTTTTGGGCAGAAGCCATAAATACCTCTGTATACTTAAGGAATCGATCAGTTGTTACTGGATTAAACAACATGACTCCATATGAAGCCTGGACAAAGAAAAAACCTGACTTAAGTCATGTACGTATTTTTGGAAGTAAGGTTATGATGCACATACCAAAAGAAAAGCGCTTAAAATGGGATATGAAGGCTAAAGAACTTATTTTGGTAGGCTATGCAGACAATGTAAAAGGCTATAGGGTTTATAACCCAGAAAATAACTCTGTCACAACTAGCAGAGACATTATAATAATGGAGAAAACTGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAGGAAGTGACTCATATGACAGTTTTTCTGAAACACCATCAGAACCAGAACCTTCATTATTAGAATTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAATTAA
Protein
MATNYLINVPKLKGRDNYSEWCFAAENFLVLEGMKHCIKPEPGKEIASADDEKTKAKLIMTIDPSLYVHVKTVKSSKELWDKLRQLFDDSGFSRRISLLRNLISIRRDNCSSMTSYVTQIIDTAQKLSGTGFEINEEWVGSLLLAGLPEKFAPMIMAIEHSGIAINSDVIKTKLLDMSSEIGDHDPEVALWSKPKTRVDQNFNTKGEKRTSNTSNVKKKVIKCYKCKQNGHYKNQCPSLEAEKRKQSNAFSAIFLSGNFNCDSWYIDSGASKHMTAKKEYVESPSFEHEIKEIIVANKTSVPVVCSGDVNIITVVNGVEYDITVSNVLCIPSLTTNLLSVSQLIENGNKVIFKEKFCYIYNQQRTLVGKAELVDGVYRLYTKKSEQLFAATAKVSSETWHRRLGHINSTSLNKMKNGATTGISYTNKADVDKSKCTVCCKGKQARLPFQPSSTSTQDILELIHSDVCGPMENVSIGGSRYYVLFVDDYSRMVFVYFMKTKSEVFKFFKEFQSLVEKQTDRKIKILRTDNGGEYCSQDFERYLKQHGIIHQKSNAYTPQQNGVCERMNRSLVEKARCLIFDAGLHKKFWAEAINTSVYLRNRSVVTGLNNMTPYEAWTKKKPDLSHVRIFGSKVMMHIPKEKRLKWDMKAKELILVGYADNVKGYRVYNPENNSVTTSRDIIIMEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSGSDSYDSFSETPSEPEPSLLELNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
AGBW02009826    OWR49812.1    GEZM01011857    JAV93390.1    NWSH01002292    PCG68657.1    + More
PCG68658.1    GEZM01011856    JAV93393.1    GEZM01011858    GEZM01011854    JAV93389.1    KQ459875    KPJ19636.1    GBXI01011094    JAD03198.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    KL367628    KFD61291.1    NWSH01000816    PCG74073.1    NEVH01019375    PNF22597.1    KL367553    KFD64618.1    NEVH01002725    PNF41351.1    NEVH01006980    PNF36330.1    NEVH01006721    PNF37230.1    LBMM01004924    KMQ91985.1    JXUM01099713    KQ564513    KXJ72145.1    GEZM01045162    JAV77889.1    GDHF01030254    JAI22060.1    GANO01000510    JAB59361.1    GEZM01045163    JAV77888.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    GFTR01008662    JAW07764.1    KL367691    KFD60150.1    LBMM01012645    KMQ86082.1    GBHO01020706    JAG22898.1    JYDL01000068    KRX18751.1    GDHF01029191    JAI23123.1    GBHO01026221    JAG17383.1    GANO01000659    JAB59212.1    GANO01000660    JAB59211.1    AAZX01000499    KL367527    KFD66146.1    KL367480    KFD71809.1    GEHC01000868    JAV46777.1    GEHC01000867    JAV46778.1    CM007900    OTG06758.1    JYDP01000258    KRZ01816.1    GGFL01004951    MBW69129.1    GGFM01000952    MBW21703.1    GGFM01000953    MBW21704.1    CM003610    KYP61490.1    X13777    JYDO01000104    KRZ71003.1    GBXI01017107    JAC97184.1    GDHF01029405    JAI22909.1    FJ544857    ACL97387.1    NCKU01012701    RWS00004.1    GFTR01008771    JAW07655.1    JYDT01000069    KRY86576.1    JYDH01000330    KRY26802.1    GDHF01029905    JAI22409.1    GDHF01000873    JAI51441.1    CM003608    KYP66486.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    JYDJ01000808    KRX33413.1    AY830138    AAV88069.1    KQ460882    KPJ11482.1    GEDC01002834    JAS34464.1    OIVN01006239    SPD28653.1    JYDJ01000136    KRX42725.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    D83003    BAA11674.1    KL367637    KFD61067.1    KQ460208    KPJ16606.1    GBHO01036544    JAG07060.1    JYDK01000071    KRX78123.1    GDHC01012180    JAQ06449.1    JYDQ01000379    KRY07987.1    LVZM01023578    OUC39908.1    GAMC01019997    JAB86558.1    GAMC01019995    JAB86560.1    GBXI01002679    JAD11613.1    GAMC01019998    JAB86557.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF04500   FLYWCH
PF05380   Peptidase_A17
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR007588   Znf_FLYWCH       
IPR008042   Retrotrans_Pao       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
4NYF     E-value=0.0282376,     Score=91

Ontologies

Topology

Length:
963
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01274
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00018
outside
1  -  963
 
 

Population Genetic Test Statistics

Pi
274.206247
Theta
122.109743
Tajima's D
-0.693913
CLR
11.348941
CSRT
0.19954002299885
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号