SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13257
Annotation
PREDICTED:_uncharacterized_protein_LOC106713896?_partial_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 2.865
 

Sequence

CDS
ATGCTTAGTCTATCCGGTGTGCGGCTGTCGGCTGTAGAAGACCGAATAAAGGTGAATCGGGGTATATTTCAGGGTGATTGTCTGAGTCCATTGTGGTTTTGCCTCGCCCTGAATCCTCTCAGTTCATTACTGGAGGCTTCGAGGACAGGCTTTCAGTTCCAAAGGGGGGGCTTGAAAGTGTCCCACTTGTTCTACATGGATGACCTCAAGTTGTACGCTCCTCATGCTGCAGGCTTCAGGCGACTGCTTGACATCACTTGTGATTTCAGTAGTCGCATTAGGATGATGCTGGGAGTCGACAAGTGTGCGGTTCTCCATGTAGAGAGAGGGAGCATAGTCTCATCGGACCGTTTACCTGTATCCGATGGGATAAACCTTCGGGCACTCTCCGAGGGAGAAACATACCGGTACCTGGGCATGTCGCAAAATTTAGGTATTGACGTGGCGGTCGTCAAACAGGCTGCATGCGACGTGTCTTGTGAACGTTTGACAAAAGTTTGTAAGAGCCTTTTGTCGGGCGTGAATAAGACAAGGGCGTTTAACGGCTGGGCGATGCCCGTCCTGTTGTATACCTTCGGCGTGCTCAGGTGGACTCAGACCGAACTGGATGCCCTGAATAGAAAAGTCCGCTCAATTATGACCCTCCATAGGATGCTCCACCCGAAGTCCTCGGTAATGAGATTGTACATTCCGCGGAAGTGTGGTGGCCGGGGCCTATTTAGCGCCAAGGTCATGCACAACAGTGGGGTGTGCAGTCTCAGGAAATATTTCCTATCGAGGGCTGACAGTGTGATGCACAGAGAGGTCATGGAATGCGACAAAGGACTGACCCCGCTAGCCCTGGCCAGAGACGGGTGGCAATCACCGGCGGTACTCAGTACCTCTGACCGTGAGGCCATATGGAAAGGGAAAGAGCTGCACGGACGCTTCTTTCAGGCACTGCATGAGCCTCACGTGGACAAAGAAGCCTCCGTGCACTGGCTGCGATTCGGTGACCTCTTTGGGGAATCCGAGAGTTTTGTCTGTGCAATACAGGATCAGGTTATCAGGACGAACAACTATAGGAAGCACATTCTGAGGGATGGGACAGCTGACATCTGTCGATTATGCCGCCGACCGGGTGAATCCCTCAGACATGTCACCTCTGGTTGTTCTATGCTTGCTAACACTGAGTACTTGCACAGACATAGCCAAGCAGCCAGAATCCTCCACCAAGAGCTCGCCCTTAAGTATGGCCTTATCGAACAGAGGCTACCGTATTATAAGTACCAGCCGGACGCTGTACTCGAAAACGACCGTGCCAAGCTCTACTGGGACCGGCCCATCATTACGGACAGGACTATTCTTGCGAATAAGCCTGATATCGTGCTGATGGACCAGACGGAGTCTCGGGTATTTCTGGTGGATATCACCACCCCCTACGACGAGAACCTCGTGCGGGCCGAGGCAGATAAAAAGACCAAATTTGGACCTGGCGCACGAGGTGACCGACATGTGGAGGGTGGTATCTATAGAAATAATCCCGGTAGTTGTGTCGGTGAATGGTTTGGTCCCTAA
Protein
MLSLSGVRLSAVEDRIKVNRGIFQGDCLSPLWFCLALNPLSSLLEASRTGFQFQRGGLKVSHLFYMDDLKLYAPHAAGFRRLLDITCDFSSRIRMMLGVDKCAVLHVERGSIVSSDRLPVSDGINLRALSEGETYRYLGMSQNLGIDVAVVKQAACDVSCERLTKVCKSLLSGVNKTRAFNGWAMPVLLYTFGVLRWTQTELDALNRKVRSIMTLHRMLHPKSSVMRLYIPRKCGGRGLFSAKVMHNSGVCSLRKYFLSRADSVMHREVMECDKGLTPLALARDGWQSPAVLSTSDREAIWKGKELHGRFFQALHEPHVDKEASVHWLRFGDLFGESESFVCAIQDQVIRTNNYRKHILRDGTADICRLCRRPGESLRHVTSGCSMLANTEYLHRHSQAARILHQELALKYGLIEQRLPYYKYQPDAVLENDRAKLYWDRPIITDRTILANKPDIVLMDQTESRVFLVDITTPYDENLVRAEADKKTKFGPGARGDRHVEGGIYRNNPGSCVGEWFGP

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
518
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18162
Exp number, first 60 AAs:
0.06797
Total prob of N-in:
0.00678
outside
1  -  518
 
 

Population Genetic Test Statistics

Pi
27.914845
Theta
36.944422
Tajima's D
-0.534166
CLR
118.317268
CSRT
0.234888255587221
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号