SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13255
Annotation
unnamed_protein_product_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.352 Nuclear   Reliability : 1.934
 

Sequence

CDS
ATGGTAGACCAGTCAACGATCCCCTTAGCTGATCAAGGATACCATACACCAGCTCCAATTGATCTGTTGTTAGGCTCGGATATCCTCGGACAGGTTTTAGATGGGACTAAAGTCTCATTGGGGCCCGGCAGGCCAATAGCCTTCGGCACGATATTTGATTTTGCATTGTTAGGACCCATACACGATTTGTATACTGCTCCTGTAAGCAAAACTGAATCGACTCACATTGTCAGCGCACAACCAGAACTCGAGGTATCTACACATGACATTCGCAAGAGCCTTGAGAAGTTCTGGGAATCTGAAGAGCCCCAACTTCATGTTGAAACTACCCCTTTGCAAGATCAGTGTGAAGAAATATTCCGCACTACCACTACTCGTAAACCCTCAGGTCAATATACGGTAACTTTACCCTTTTTACATAATATGCCCGAGTTAGGAAGTACCCATGCCATAGCATTGCGTAGGTTTCTTAATCTTGAAAAGAAGTTAAAAGCTGACCCATATCTCCGTGTGAAATACATTGACTTCATGGCAGATTATCAGAAGCTGGGTCACATGTCCCCATGCCACCCGAGTACTTTTGCTCATAAACCTCACTTCTATATCCCTCATCATGGTATCTTCAAGTCGGGATCAGACAAGCTACGCACTGTTTTTGATGGTAGCTGTAAAAGCTCAAATGGTGTCAGCCTAAATGACTGTTTACACACTGGTCCAGCTCTTCAACAGGACATTGTCGATATTATCTTGTCGTTTAGAACTCATCCCGTAGTTTTCAGCACTGACATTTGTATGATGTTCAGAAACATACTCATACATCCCGATCAGAGGCGTTACCAGCTCATTCTCTGGCGCTCTTCGCCAGATCAGCCCCTCCTTACATATGCTTTAAACACTGTTACATACGGGTTACGATCAAGCCCATATCATGCTATACGCACTTTAATCCAATTAGCGGATGATGAAGGTCATCGCTATCCTGCAGCTGCTCAAGTGCTGCGCAAGTCCATATTTGTCGATGATATTCTCACTGGTCACGATTCTGTAGTAAAGGCTCAAGCTCTCCAAAACGACTTGATTAACTTACTAGCCTTAGGTGGTTTTCAGCTCAGTAAATGGACCTCAAACTGCCCTCAGTTTCTCGAAAGATTTCCCGATGATCAGTGTGACATGCCCAAGGACTTTGACATCAGCCCAGACTCCAACTCCATAAAAGTATTAGGTATACAGTGGATTCCTCAATCGGATGAGTTAACTTATCGTATTTCTCTCCCCTCAATAGAACAAATTACCAAACGCTCAATCCTCAGCACAGTCGCCTCTCTTTATGACCCTAACGGTTGGGTTACTCCTGTTATCTTCCGCGCAAAGCTTCTCCTACAGAAGCTGTGGCTTCTAAAGTTAGAATGGGACGAACAAACCCCTGTTGAAGTGCAGACAGAATGGAACCGCATATCACAAGATCTGCCCCAATTGTCAACCCTTCGTTTGCCTCGCCTTATTTGTACAAACAAATTAAAGTCTACTTACTCGCTTCACGGGTTCGCAGACGCCTCAGAGGCAGGTTTTGCTGCCGTTATTTATCTCCATGAACTCGATGAGCACAGATGTGTCAACGTATACCTCGTAATTGCTAAATCACGAGTCGCACCCGTTAAAAATCGTCTTACCATCCCCAAAATGGAGTTATCTGCTGCAAGTCTCTTAACACAGCTTATGATACGTGTCTCGACTCAATTGTTGTCCCATATTACCATAAAGCAACACATATGCTGGTCAGACAGTACCATTGTCCTAGCATGGCTAAACACACCTCCTCATAGACTTCAGGTCTTTGAAGCTAACAGGGTTGCCAAGATAACATCCAATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCAGCTCATGATCTTTGGTGGTCTCCTAGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCATTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATATAGCAGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGCGCTCTGGTCCCTTGACAGTTGGAGAACGTAGAGATGCTCTGTTATTATGGGTTCGCTCTGTTCAACACAATGAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACGATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGCCCACTAGTTGATCTCATCGTAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTGACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCGTGTACAAATGCATTAGATGTTTCCGATATCGCGCTCAGGCCAGGGCTCCGTTGATGGCTGATTTGCCCGCAGACAGAGTCACACCCCAGCCAGTATTTAGTCAGGTCTCTACAGATTTTGCTGGCCCGTTTCTCATTAAATCTAGTACTTTACGTAACGCCAAACTCATGAAGGCATACTTTTGTGTCTTTGTTTGCTTATCTACTAAGGCGGTTCACTTGGAGCTCGTTTCGTCACTCAGCACTGAAGCGTTTCTTGCTGCAATGCAACGGTTTGTATCGCGTCGCGGTACTCCTACTCTTGTCCGTTCTGACTGTGGCACAAATTGTGTAGGAGCTAAGAATCATCTCATTGAGTATGTTGACCGGATGATTTCTGCATTTGGTGATGAAGCCCCATCCAAAACCACAATTTATCGCTGGTTTGCTGAGTTTCAACGTGGACGTGTCAAGCTCAGTGATGATCCCCGTCAAGGTCGTCCAAAAACTGCAGTCACCCAAGAAAACGTTGATGCTGTGCGTAAGCTGATTGAGGAAGATCGACATATGACATACCGCGAAATTCAGGCAACTTTAGACATTGGCATGAGTCAAATACAAATAATCTTGCATGAACAATTAGGTGTAAAAAACGGTTGTTTTCCCGATGGATACCGCATTCGCTCTGTGAAGAGCAAAAAGCGGCTCGCGTTACTTGGTGCGTCAGAACTCTCGAAAGATTCCACGCAGGATCCTCAAATGCTGTATAAAATATGCTCAAATGCTGTATCAGGTGACGAATCATGGATATACGCGTACGAACCCGAAACAAAAAATCAGTCACGAGTTTGGGTTTTCGAAAATGAGTTAAAGCCAACAAAAATTGTTCGTTCACGGAGTGACGCAAAAAAAATGGTGGCCATGTTTGTCTCCAAAACCGGCCATGTTACGACTATTCCTCTTGAGGGACAAAGAACGGTTAATGCAGAATGGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGCACACACTGTCACGCAGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGGGTCCCCACCGTGCGCCTCGAGCGCTGCGAGAGCCTTATCTCGCTCTACTCGGCGCGGAGCTCCGCGAGGGGCGACGCGTCCAGTGGGCGGGAGACACCGGCGCTGTTCACCGACACGCGACAGCGGACTCGGCGGAAGCGGAAGTCGGCCCGACAGCCGGCATCCTCTGCTCCGTCTGACTCGTCCGAGGGTGAGCCTGCCAGCGCCAAATATATGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACCGGCTTCGAAAAAAGTTCCTCTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTCCCGGGAAAAAATTGAGATTGGAGTGGTTCAGCGCCTAGAGCGCTCCCTAACGGAGGTGGGTCCCTCTGACCCCCTCCGAGCTTTCGAGGTGGTCGGAAAATTAGTTTCCGCAGTCGTGGCAACATCCGGCGGTGGACTCAAGGGTGACTGCGTGCGGGCCTTAAAATCCGGAGCGGCCACCCTAGAAGAACGTCTGAGGGAAGTGGTAGACCGCACCACAACGACGGAGACGGCGGGCTTGCGGCAGGAAGTGGCCCTGCAGCACGCCCGCCTCGAGCAACTCTCGAACGAGAATGGCAAACTTCGGGCGGAGAATGGGCAGCTGCGAGTGGACATGGCCGAGTTGAGGACCATGGTTGCCGACCTCATCGAGCGGCAACGCAGCTCGGCCCCTGCCCCTCCTCCGCCCGAAGCGGAAGGCCTCAGTGAGGTGGACGAGTTGAGGCGGCAGCTCCTCATACAGGAGGCGCGCAGCTCCAAAGTGGAGCGCGCGAGACCGCCCCTCGCTCACGAGGCTAACGGAAGTACGCCTGTGCCGGCACCCCGCAGGAGTGTGCAGCCCGCTGTAAAAGCATACAGCGGGAAGAAGAAGGCTACACCCGCGCGAGCTCCCGCTGCGGCTGCACCTAAACCCGCGGCTGTAGGGGCGCCGGCACCCACGGCCCCTGCATCAAAACCGGTGTCCGCTCCTGCCCCGTCCAAGCCTGCGAAGGCGGGGCCTGGCAGGAGCCGAAACAAAAAGAAGGGGCGGACCAACGCCGCCAAACCGGCACCGACCCCCCAGCCCCGCCCACTGCCCCCAGCCCCGGCCAACATGGACGAGGCCTGGACGACGGTGGTGCGGCGCGGGCCCAAAAAGGTTGCGGCGCCTGTCGTGCCACGCCCCAAGCCCGCCCCTACGGCCGCCGCTCCCCGTCAAGAGGGTCGAGCGGAGCCTAGGGGCCGAACTGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGAAGTCGTGGAGCTGCTGCCGGCCGCCAAAGAACGGGGCATCACGTACCACGACGTGATGACTCAGGCGCGCGGCGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCCTTAAGGTTCGGCAGACGGCCAACGGGGCCCGCCTGGTAGAATGCCCCGGCGCAAATTCCAGCGCCGCGGCAGAAAAACTGGCGGTCCGTCTGCGGAAAATCTTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTAAAGATGGCGGAGGTGAAGATTACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGACGTGGGCGCGTTGCCCGGTAGCAACGGCGAACCTCCTGGCCACCCCTCCACAGGGTCGGCCTTCGGACAGCCCAGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACAGTGGACCGCAGCGACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCGCAGCCGCGCCGCACTGTGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGCAAGTCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGTGAGTCAGTTCCCGCCGCGGCACCAGAAGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGATGTTGCTGTCGCCGCGGAGCCGTATTTCGTCCCCACTGACCAGGACTGCTGGATCGGGGACGTCGACGGCTCCGTGGCCATTATATTACGACAGTCCGCGGCGTTACCCCCCTTGGATGTGGTGGCCAGGGGACCCGGGTACGTTGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAATTCGAACGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCATGGATGCGCGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCAGCCTCTTTCTCATAAACAGAGGTTCGGTCGCGACTTGCGTGCGGTGGAACGGGCAGTCTCATGTGGACGTGACGTTCGCGTCCCCGTCCGTCGCATGCCGAACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGCGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCCTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGTCGCCGCCGTCGTCACGACGCTGCGTTCGCGGAGACGGCGGCCCAGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAGATAGTTTCCGCGCTTTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGACACGGCACGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGCTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATTGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGACGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCTGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGTCCCCTCCCCGGGCTGAGCGTAATATGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGATAAAACCCAGGCCCTGCTTTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTTGGGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGGTGCCGCGCCCTGACCCGCAAGAACGTCGCGGCTCTGCGACGTCCGCAGCGTGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACAGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MVDQSTIPLADQGYHTPAPIDLLLGSDILGQVLDGTKVSLGPGRPIAFGTIFDFALLGPIHDLYTAPVSKTESTHIVSAQPELEVSTHDIRKSLEKFWESEEPQLHVETTPLQDQCEEIFRTTTTRKPSGQYTVTLPFLHNMPELGSTHAIALRRFLNLEKKLKADPYLRVKYIDFMADYQKLGHMSPCHPSTFAHKPHFYIPHHGIFKSGSDKLRTVFDGSCKSSNGVSLNDCLHTGPALQQDIVDIILSFRTHPVVFSTDICMMFRNILIHPDQRRYQLILWRSSPDQPLLTYALNTVTYGLRSSPYHAIRTLIQLADDEGHRYPAAAQVLRKSIFVDDILTGHDSVVKAQALQNDLINLLALGGFQLSKWTSNCPQFLERFPDDQCDMPKDFDISPDSNSIKVLGIQWIPQSDELTYRISLPSIEQITKRSILSTVASLYDPNGWVTPVIFRAKLLLQKLWLLKLEWDEQTPVEVQTEWNRISQDLPQLSTLRLPRLICTNKLKSTYSLHGFADASEAGFAAVIYLHELDEHRCVNVYLVIAKSRVAPVKNRLTIPKMELSAASLLTQLMIRVSTQLLSHITIKQHICWSDSTIVLAWLNTPPHRLQVFEANRVAKITSNPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPSWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHIAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRRSGPLTVGERRDALLLWVRSVQHNEFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYDAQHPLVLPSSSPLVDLIVDHYHRINCHPGADTLHAILRQQFWILSARRVIRHRVYKCIRCFRYRAQARAPLMADLPADRVTPQPVFSQVSTDFAGPFLIKSSTLRNAKLMKAYFCVFVCLSTKAVHLELVSSLSTEAFLAAMQRFVSRRGTPTLVRSDCGTNCVGAKNHLIEYVDRMISAFGDEAPSKTTIYRWFAEFQRGRVKLSDDPRQGRPKTAVTQENVDAVRKLIEEDRHMTYREIQATLDIGMSQIQIILHEQLGVKNGCFPDGYRIRSVKSKKRLALLGASELSKDSTQDPQMLYKICSNAVSGDESWIYAYEPETKNQSRVWVFENELKPTKIVRSRSDAKKMVAMFVSKTGHVTTIPLEGQRTVNAEWRVPPAPRGRIPPCGRAIGRTLPHRFWGGTHCHAEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFTDTRQRTRRKRKSARQPASSAPSDSSEGEPASAKYMALAEGPATAAASPATGFEKSSSCGLDAASSAQSREKIEIGVVQRLERSLTEVGPSDPLRAFEVVGKLVSAVVATSGGGLKGDCVRALKSGAATLEERLREVVDRTTTTETAGLRQEVALQHARLEQLSNENGKLRAENGQLRVDMAELRTMVADLIERQRSSAPAPPPPEAEGLSEVDELRRQLLIQEARSSKVERARPPLAHEANGSTPVPAPRRSVQPAVKAYSGKKKATPARAPAAAAPKPAAVGAPAPTAPASKPVSAPAPSKPAKAGPGRSRNKKKGRTNAAKPAPTPQPRPLPPAPANMDEAWTTVVRRGPKKVAAPVVPRPKPAPTAAAPRQEGRAEPRGRTGRRRPRAPRSAAEVVELLPAAKERGITYHDVMTQARGGVNVDALGVEGGLKVRQTANGARLVECPGANSSAAAEKLAVRLRKILPDPEVVRIARPVKMAEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTTWARCPVATANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESVPAAAPEEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWIGDVDGSVAIILRQSAALPPLDVVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRMDARGEALSEWAIATSLFLINRGSVATCVRWNGQSHVDVTFASPSVACRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRHDAAFAETAAQLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATTRHERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGTMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVARRLYMGVVRSMALYGAPVWCRALTRKNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=8.61986e-09,     Score=152

Ontologies

Topology

Length:
2853
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10876
Exp number, first 60 AAs:
0.01328
Total prob of N-in:
0.00088
outside
1  -  2853
 
 

Population Genetic Test Statistics

Pi
1.798554
Theta
10.075711
Tajima's D
-1.379197
CLR
0.857664
CSRT
0.0740462976851157
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号