SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13253
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.013
 

Sequence

CDS
ATGTGCGAGCCTTTAGATATGGATTTAGCTATGGAGGACTTCGAATTTACGCAGGATGAATGGAAGCAAATCAACGCGTTAGAAATTTCTTTTTCGATCGCTTCTATAAACAATGACGCTCTCGTAGAATCGGATAGTGAACCCATGCAATTACCGAAAAAGAAAAGACGTTTGGTTATCGCAAGTGATAGTGATAGTGACAGTGAGTCGGCTGAAAATTTTGTTGCCGCCAATATATCGCAAAATGACCGTATTTCCTCAAAATGGTCGAGGCCAAAAAGACGACAGCCATCAGTGATTCCTTTCACCGAGTTCGAGGGTATGAAACCTCCATATTCTAATTTGCTGAAAGAAGCTGGCCCTGACCAGTATTATGATCTATTGGTGCCTGAAGAAATTCTTGAAATGATTGCTGAGCAGACAAATTTGTTCGCAAGTCAAAACATCACAGCCAGGCAAACAAAGCCTGGATCAAGGTCTCATTCATGGAAGCCAACAAACAAGACAGAAATAAAACAGTTTCTTGGGCTGGTCTTGTTTATGGGCGTAGTAAAGCTGCCGAAATTAGCTTATTATTGGCGCAAAGACAAGATACTTGGACAAACTTTTCCAGCCACCGTTATGAGTAGGAACCGCTTCGAGTTACTACTGCAATACCTACACTTTAGCGACAATTTATCTGTCGACAGAAACGATCGTATTGCCAAAATAAGACCTTTAATCGATGCTCTCAATGCTACTTTCCAGAAATATTATTCACCTAAAGAAGATGTTTGTGTGGATGAAAGCCAAGTACCTTTCAGAGGTCGAATAATATTCAGGCAATACAATAAAAGTAAGCGACACAAGTATGGCATGAAGCTATTTAAGTTATGTACTGTTCCCGGATATACTTGCAAACTTAATTTGTATAGTGGGAAAAACATTGACGCAATAAATACTACGCCAACAAATCTGGTGATGGCACTATGTGAAAATATATTTGACAAAGGACACACGCTAGCAACTGATAATTGGTACACTAGCTTGCAACTGGCTTATCGGTTATTGGAGAAGCAAACCCATTTAATTGGCACATTGCGAAAAAACAGAAGAGGATTGCCTAAAGCTGTTGTTGATTCGAAACTGCAAAAAGGTGAAACAATGGCTATGGAGAATGAAGATGGAGTAACAGTGCTTAAATGGAAAGATAAGAGGGACGTGCTTATGCTGTCGACAAAGCATTCCGACAAAATTGCTGTGGTGGTGAAAAAAGGCAAACAGATTCGTAAATCAAAAGTTATTTTGGATTATAATAAATCGAAAGGGTCTGTAGACATGAGTGACCAGATGGGTGCCTATTCTTCGCCATTGCGGAAAACCGTAAAATGGTATAGAAAATTGGCAATAGAACTACTTCTAAATACGGCAGTTGTAAATGCTTGGGTCATGTACAATGAAAATAAGCAGAGCAAATCTTCAATTGTCGACTTTAGGAGGGCTCTCATAAATTATTTGACTCGGCCAGCAGATTCCCAAGAAATAATTATCAATGAAAGACCTAAAAGACTCAAGCATGTTCTAAAATTAAAGGAAGGAAAAGTAAGAGACACGCGTCGTTTTTGCGTGAAATGTTATAAAGATTCAGTACAGGAATTTGGTCGTAAAGTAGCTAAGAATAAAGCTAAGAAATAA
Protein
MCEPLDMDLAMEDFEFTQDEWKQINALEISFSIASINNDALVESDSEPMQLPKKKRRLVIASDSDSDSESAENFVAANISQNDRISSKWSRPKRRQPSVIPFTEFEGMKPPYSNLLKEAGPDQYYDLLVPEEILEMIAEQTNLFASQNITARQTKPGSRSHSWKPTNKTEIKQFLGLVLFMGVVKLPKLAYYWRKDKILGQTFPATVMSRNRFELLLQYLHFSDNLSVDRNDRIAKIRPLIDALNATFQKYYSPKEDVCVDESQVPFRGRIIFRQYNKSKRHKYGMKLFKLCTVPGYTCKLNLYSGKNIDAINTTPTNLVMALCENIFDKGHTLATDNWYTSLQLAYRLLEKQTHLIGTLRKNRRGLPKAVVDSKLQKGETMAMENEDGVTVLKWKDKRDVLMLSTKHSDKIAVVVKKGKQIRKSKVILDYNKSKGSVDMSDQMGAYSSPLRKTVKWYRKLAIELLLNTAVVNAWVMYNENKQSKSSIVDFRRALINYLTRPADSQEIIINERPKRLKHVLKLKEGKVRDTRRFCVKCYKDSVQEFGRKVAKNKAKK

Summary

Similarity
Belongs to the universal ribosomal protein uS3 family.
EMBL
GAIX01005691    JAA86869.1    GBBI01004440    JAC14272.1    GBBI01004438    JAC14274.1    + More
GAIX01013935    JAA78625.1    ATLV01021248    KE525315    KFB46173.1    ABLF02018838    JARK01001552    EYB90668.1    GAIX01004551    JAA88009.1    ABLF02025866    ABLF02025869    ABLF02025877    GFXV01007414    MBW19219.1    GGMS01006604    MBY75807.1    ABLF02011361    ABLF02011864    ABLF02011866    ABLF02042566    KE125214    EPB70205.1    UYSL01019948    VDL71548.1    ABLF02010187    ABLF02050407    ABLF02038619    GDRN01069744    JAI63996.1    ABLF02012265    ABLF02029982    GECU01034165    JAS73541.1    KE125300    EPB69401.1    GBBI01004439    JAC14273.1    ABLF02030622    ABLF02030627    JARK01001390    EYC10641.1    ABLF02016107    JARK01001356    EYC20951.1    JARK01001346    EYC26204.1    ACPB03026393    EYC26339.1    EYC26340.1    GAIX01003729    JAA88831.1    KE647018    EQB62075.1    GALX01005527    JAB62939.1    ABLF02029983    UZAF01018515    VDO52364.1    CAVP010055412    CDL94120.1    GDQN01004768    JAT86286.1    UZAH01001106    VDO19503.1    ABLF02017387    GGMS01012057    MBY81260.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    LSMT01000021    PFX32631.1    UXUI01007140    VDD85673.1    JOJR01000056    RCN47811.1    AB300557    BAF82020.1    GEDC01003168    JAS34130.1    AB300558    BAF82021.1    AB300556    BAF82019.1    ABLF02028028    JARK01001477    EYB97365.1    GBIH01001829    JAC92881.1    ABLF02006169    ABLF02055685    BABH01041064    KN716593    KJH43099.1    AB300559    AB300560    AB300561    AB300562    BAF82022.1    BAF82024.1    GEBQ01027849    JAT12128.1    AB300563    BAF82026.1    ODYU01000651    SOQ35792.1    ABLF02014543    ABLF02028765    ABLF02023363    ABLF02023369    ABLF02055317    GECU01014964    JAS92742.1    UZAF01017203    VDO39079.1    GECU01033435    GECU01003618    JAS74271.1    JAT04089.1    HAEI01002033    SBR78690.1    BABH01021160    BABH01021161    BABH01021162    BABH01021163    HAEH01008939    SBR85849.1    GEBQ01017560    JAT22417.1    LSMT01000060    PFX29817.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF05699   Dimer_Tnp_hAT
PF02037   SAP
PF00188   CAP
PF05380   Peptidase_A17
PF13842   Tnp_zf-ribbon_2
PF00189   Ribosomal_S3_C
PF07650   KH_2
PF05225   HTH_psq
PF13613   HTH_Tnp_4
Interpro
IPR029526   PGBD        + More
IPR008906   HATC_C_dom       
IPR012337   RNaseH-like_sf       
IPR003034   SAP_dom       
IPR036361   SAP_dom_sf       
IPR014044   CAP_domain       
IPR035940   CAP_sf       
IPR008042   Retrotrans_Pao       
IPR032718   PGBD4_C_Znf-ribbon       
IPR005703   Ribosomal_S3_euk/arc       
IPR036419   Ribosomal_S3_C_sf       
IPR001351   Ribosomal_S3_C       
IPR004044   KH_dom_type_2       
IPR018280   Ribosomal_S3_CS       
IPR015946   KH_dom-like_a/b       
IPR009019   KH_sf_prok-type       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR027805   Transposase_HTH_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF68906   SSF68906       
SSF55797   SSF55797       
SSF54821   SSF54821       
SSF54814   SSF54814       
SSF46689   SSF46689       
SSF57667   SSF57667       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
557
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.10625
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.03548
outside
1  -  557
 
 

Population Genetic Test Statistics

Pi
195.717857
Theta
196.099461
Tajima's D
-0.275926
CLR
0
CSRT
0.298785060746963
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号