SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13252
Pre Gene Modal
BGIBMGA004727
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.063
 

Sequence

CDS
ATGTTAAAGACGTTCTTGTTTGTAGCCTGTATCGCTAATGTGCTTCTAGCAGACTCTACTGAAGAAATCAAATGTAATCAGAATGAGGTATTCGATTTATGTCCTGCCCCATGTCCTCCAAGAAGATGCGGTATAGACCCAGCCTTAGTGCTTTGTGCTCCGTCGCCTACAATCGGAGATCCAGGTTGCGAGCCCGGCTGTCGATGTATTGACGGTTACGTCAGGAATGATACAGATGTTTGTATTCCGAAAGAAGAATGTCATATGGATTTAGCTATGGAGGACTTCGAATTTACGCAGGATGAATGGAAGCAAATCAACGCGTTAGAAATTTCTTTTTCGATCGCTTCTATAAACAATGACGCTCTCGTAGAATCGGATAGTGAACCCATGCAATTACCGAAAAAGAAAAGACGTTTGGTTATCGCAAGTGATAGTGATAGTGACAGTGAGTCGGCTGAAAATTTTGTTGCCGCCAATATATCGCAAAATGACCGTATTTCCTCAAAATGGTCGAGGCCAAAAAGACGACAGCCATCAGTGATTCCTTTCACCGAGTTCGAGGGTATGAAACCTCCATATTCTAATTTGCTGAAAGAAGCTGGCCCTGACCAGTATTATGATCTATTGGTGCCTGAAGAAATTCTTGAAATGATTGCTGAGCAGACAAATTTGTTCGCAAGTCAAAACATCACAGCCAGGCAAACAAAGCCTGGATCAAGGTCTCATTCATGGAAGCCAACAAACAAGACAGAAATAAAACAGTTTCTTGGGCTGGTCTTGTTTATGGGCGTAGTAAAGCTGCCGAAATTAGCTTATTATTGGCGCAAAGACAAGATACTTGGACAAACTTTTCCAGCCACCGTTATGAGTAGGAACCGCTTCGAGTTACTACTGCAATACCTACACTTTAGCGACAATTTATCTGTCGACAGAAACGATCGTATTGCCAAAATAAGACCTTTAATCGATGCTCTCAATGCTACTTTCCAGAAATATTATTCACCTAAAGAAGATGTTTGTGTGGATGAAAGCCAAGTACCTTTCAGAGGTCGAATAATATTCAGGCAATACAATAAAAGTAAGCGACACAAGTATGGCATGAAGCTATTTAAGTTATGTACTGTTCCCGGATATACTTGCAAACTTAATTTGTATAGTGGGAAAAACATTGACGCAATAAATACTACGCCAACAAATCTGGTGATGGCACTATGTGAAAATATATTTGACAAAGGACACACGCTAGCAACTGATAATTGGTACACTAGCTTGCAACTGGCTTATCGGTTATTGGAGAAGCAAACCCATTTAATTGGCACATTGCGAAAAAACAGAAGAGGATTGCCTAAAGCTGTTGTTGATTCGAAACTGCAAAAAGGTGAAACAATGGCTATGGAGAATGAAGATGGAGTAACAGTGCTTAAATGGAAAGATAAGAGGGACGTGCTTATGCTGTCGACAAAGCATTCCGACAAAATTGCTGTGGTGGTGAAAAAAGGCAAACAGATTCGTAAATCAAAAGTTATTTTGGATTATAATAAATCGAAAGGGTCTGTAGACATGAGTGACCAGATGGGTGCCTATTCTTCGCCATTGCGGAAAACCGTAAAATGGTATAGAAAATTGGCAATAGAACTACTTCTAAATACGGCAGTTGTAAATGCTTGGGTCATGTACAATGAAAATAAGCAGAGCAAATCTTCAATTGTCGACTTTAGGAGGGCTCTCATAAATTATTTGACTCGGCCAGCAGATTCCCAAGAAATAATTATCAATGAAAGACCTAAAAGACTCAAGCATGTTCTAAAATTAAAGGAAGGAAAAGTAAGAGACACGCGTCGTTTTTGCGTGAAATGTTATAAAGATTCAGTACAGGAATTTGGTCGTAAAGTAGCTAAGAATAAAGCTAAGAAAGTGAAAATCCAATGTAATAAGAATGAGGTATTCGATTTATGTCCTGCCCCATGTCCTCCAAGAAGATGCGGTATAGACCCAGCCACAGTGAATTGTATTCCGTCGCCTAAAATCGGAGATCCAGGTTGCGAGCCCGGCTGTAGATGTATTGACGGTTACGTCAGGAATGATACAGATGCTTGTATTCCCAAAGAAGAATGTCGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCTGCCTTGGATTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAAGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGGCGGCAGAGTGCCACCATTGTGGTTGCGACTTGGATACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGAGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAATGACTTGTCGTTGCCGAGTGTTGTGGCCTCGATGCTCGGCGACGACGAGTCGTGGAAGGCGGTGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGTGGCGGGGCGCGTGAGAGACGCACAATCCCGTCGCCGTCGAGCGGGGACCAGGGAGGCGAATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MLKTFLFVACIANVLLADSTEEIKCNQNEVFDLCPAPCPPRRCGIDPALVLCAPSPTIGDPGCEPGCRCIDGYVRNDTDVCIPKEECHMDLAMEDFEFTQDEWKQINALEISFSIASINNDALVESDSEPMQLPKKKRRLVIASDSDSDSESAENFVAANISQNDRISSKWSRPKRRQPSVIPFTEFEGMKPPYSNLLKEAGPDQYYDLLVPEEILEMIAEQTNLFASQNITARQTKPGSRSHSWKPTNKTEIKQFLGLVLFMGVVKLPKLAYYWRKDKILGQTFPATVMSRNRFELLLQYLHFSDNLSVDRNDRIAKIRPLIDALNATFQKYYSPKEDVCVDESQVPFRGRIIFRQYNKSKRHKYGMKLFKLCTVPGYTCKLNLYSGKNIDAINTTPTNLVMALCENIFDKGHTLATDNWYTSLQLAYRLLEKQTHLIGTLRKNRRGLPKAVVDSKLQKGETMAMENEDGVTVLKWKDKRDVLMLSTKHSDKIAVVVKKGKQIRKSKVILDYNKSKGSVDMSDQMGAYSSPLRKTVKWYRKLAIELLLNTAVVNAWVMYNENKQSKSSIVDFRRALINYLTRPADSQEIIINERPKRLKHVLKLKEGKVRDTRRFCVKCYKDSVQEFGRKVAKNKAKKVKIQCNKNEVFDLCPAPCPPRRCGIDPATVNCIPSPKIGDPGCEPGCRCIDGYVRNDTDACIPKEECRSSVVIAPSPLRRRVYWLGRCLGFWKRRRSPLTISGGLTFVPGAWRVPAPVWSERGRPNLGGPCWSHGPDGWLILRLVVGPSRRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPAAECHHCGCDLDTAEHTLVACPAWEEWRRVLVAKIGNDLSLPSVVASMLGDDESWKAVLDFCECTISQKEVAGRVRDAQSRRRRAGTREANLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1CCV     E-value=0.00395744,     Score=99

Ontologies

GO

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.998887
 
 
Length:
918
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.31034
Exp number, first 60 AAs:
0.00439
Total prob of N-in:
0.01371
outside
1  -  918
 
 

Population Genetic Test Statistics

Pi
176.660924
Theta
146.276038
Tajima's D
0
CLR
191.371571
CSRT
0.364481775911204
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号