SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13235  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA009974
Annotation
PREDICTED:_2-oxoglutarate_dehydrogenase?_mitochondrial_isoform_X2_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.275 Mitochondrial   Reliability : 1.525
 

Sequence

CDS
ATGCATCGAGCAAGGATAGTGTTTAACATCTCTAAATCTGGCCAAAGTGAGAGATTTGCATCATGGCTCCTAAACAAACCACAGACTGCCGCGGTTTCAGTAAATGCCAACAGGCTGAAGAGCTCCACCGCGGCGGAACCCTTCCTTAATGGCTCCAGTTCAGCTTACGTCGAGACCATGTACAATGCATGGCTCGCCGACCCAAACTCCGTACACGCGTCTTGGGATGCATTTTTCCGCAATGCGACAAACGGAGCTCAGCCAGGCGCCGCATACACGCCGCCGCCCAATCTCGCGCCATACAACAAGAATGAGGTCCCGCTCACATCGCTCGTGCCATCTAGCGGCGGAATGCCTTCGATTTCAGCAGGTTCCCCTATAAACGAGAAGATAATCGACGATCACCTCGCCGTGCAGGCTATCATCAGGAGTTACCAGGCTCGCGGTCACCTGGCGGCCGATGTGGACCCGCTCGGCATCACGACGGCCACGCTTCCGGAACTGGGCATGCGTGCACCAAGTTCCGAGCTCATCATGAGGAAATATTTCAATTTCGATGAAGCCGACATGGACAGGGTATTCAAACTACCCTCAACTACGTTTATCGGCGAAAAAGAAAAAGCGCTCCCGTTGAGAGAAATTCTGAATCGTTTGGAGCAAGCGTACTGCAACAACATCGGTATTGAGTTCATGTTCATAAATTCCCTGGAACAATGCAACTGGATCCGACAGCGCATGGAGCCACCGAACGTAACAAAGATGAACGCTGACCAGAAGAGGCTCATCCTGGCTCGTCTAACCAGATCAACTGGGTTCGAGAATTTCCTCGCTAAGAAATGGTCCTCCGAGAAGCGTTTCGGTTTGGAAGGGTGCGAAATTTTGATTCCGGCGATGAAGCAAGTCATCGACGTTTCCACGAAACTCGGAGTCGAATCCATCATTATGGGCATGCCCCATAGAGGGCGCCTCAACGTACTCGCGAACGTGTGCCGTAAGCCTCTGCACCAGCTGTTCACACAGTTCGCCGGTCTCGAAGCTGAGGATGATGGTTCCGGCGACGTGAAATATCACTTGGGCACGTACATCGAGCGTTTGAATCGCGTTACCAACAAGAACATTAGATTGGCTGTTTGCGCGAACCCCTCGCACTTGGAGGCCGTCGACCCCGTGGTGCAGGGCAAGACCAGAGCCGAGCAGTTCTACAGGGGAGACAACGAGGGCAAGAAGGTGATGTCGATCCTGCTGCACGGCGACGCGGCGTTCGCTGGTCAGGGCGTCGTGTTCGAGACGATGCACCTGTCGGACCTGCCCGCCTACACCACGCACGGGACCATACACATCGTCGCCAACAACCAGATCGGGTTCACGACCGACCCCAGGCACTCCAGATCTTCCGCCTACTGTACAGACGTGGCCCGCGTTGTTAACGCTCCGATATTCCACGTGAACGGTGACAATCCTGAGGCTGTAATGCACGTTTGTAACGTGGCTGCCGAATGGAGAGCCACGTTCCACAAGGACGTTGTCATTGACATCGTCAGCTACAGGAGAAACGGACACAACGAAGTTGACGAGCCGATGTTCACTCAGCCCCTCATGTACCAGAAGATTCGTAAGACCAAACCAGTATTGGAGAAATACGCGGACCAGTTGATCGCGGAAGGAGTCGTCACAGCTGAGGAGGTTAAAGACGTGAAGGACAAATACGAAAAGATCTGCGAGGACGCGTACAACCAAGCCAAACAGGAGACCCACATCAAATACAAGGACTGGCTCGACTCGCCCTGGTCGGGCTTCTTCGAGGGGAAGGACCCCCTAAAGATGTCGGCCACCGGTGTAGTGGAGGAGACCCTCGTGCACATCGGGCGTCGGTTCTCATCCCCCCCTCCCAACGCCGCGGAGTTCGAGATCCACAAGGGGCTGCTTCGTATCCTGAAGTCGCGCATGGAGATGGTCGACAACCGTACAGTGGACTGGGCGCTCGCGGAGGCGATGGCCTACGGATCTCTGCTCAAGGAGGGCATCCACGTGCGTCTCTCTGGTGAAGATGTTGAGCGAGGCACATTCTCTCACAGACATCACGTGCTCCACCACCAGAAGGTCGACAAGGCCACTTACTGCGCCTTGGCACATCTGTACCCCGACCAGGCTCCCTACACTGTGTGCAACAGCTCACTGTCTGAGTATGGTGTCCTGGGTTTCGAGGTCGGCTACTCCGTAACGAACCCGAACGCCCTGGTGCTGTGGGAGGCCCAGTTCGGAGACTTCAACAACGTGGCCCAGTGCATCATCGACCAGTTCATCTCCAGCGGACAGGCCAAGTGGGTGCGCCAGTCCGGGATTGTACTGCTGCAGCCTCACGGCATGGAGGGGATGGGCCCCGAGCACTCCTCGGCTCGTTTGGAGAGGTTCTTGCAGATGTGCTCCGACGACCCGGACTACATGCCCCCGGAAAGCCCCGACTATGAAGTGCGTCAGCTTCACGACTGCAACTGGATCGTAGCGAACTGTTCGACTCCGGCGTCGTATTTCCACATTCTGCGTCGCCAGATCGCTCTGCCCTTCCGGAAGCCGCTCATCTTGATGACGCCCAAGTCTCTGCTGCGTCATCCCGAATGTAAATCCTCCTTTGACGACATGAAGGAGGGAACCAATTTCAAGAGAGTGATCCCCGAAGAAGGTCCAGCCTCCGAGAACCCTCAGAATGTACGCAAACTCGCATTCTGTTCCGGACGCGTCTACTACGATCTACTCAAACAGAGACGCGACAAGGGACTCGAAAAGGACATTGCTATTGCTAGACTCGAGCAGATCTCTCCGTTCCCGTACGACCAGGTGAAGGCCGAGATCGCGAAGTACCCGAACGCTCAGCTCGTGTGGAGCCAGGAGGAGCACAAGAACATGGGCTCGTGGAGCTACATCGAGCCGCGCTTCCGCACCCTCCTGCAGAACCAGAAGCAGATTAGCTATAACGGTCGCGCCACAGCCGCCTCTCCAGCGACCGGCTCGAAGGCCGCCCACAACAAGGAACTGAGGAACCTTCTCGAAGAGTTCTGCGTGTTATAA
Protein
MHRARIVFNISKSGQSERFASWLLNKPQTAAVSVNANRLKSSTAAEPFLNGSSSAYVETMYNAWLADPNSVHASWDAFFRNATNGAQPGAAYTPPPNLAPYNKNEVPLTSLVPSSGGMPSISAGSPINEKIIDDHLAVQAIIRSYQARGHLAADVDPLGITTATLPELGMRAPSSELIMRKYFNFDEADMDRVFKLPSTTFIGEKEKALPLREILNRLEQAYCNNIGIEFMFINSLEQCNWIRQRMEPPNVTKMNADQKRLILARLTRSTGFENFLAKKWSSEKRFGLEGCEILIPAMKQVIDVSTKLGVESIIMGMPHRGRLNVLANVCRKPLHQLFTQFAGLEAEDDGSGDVKYHLGTYIERLNRVTNKNIRLAVCANPSHLEAVDPVVQGKTRAEQFYRGDNEGKKVMSILLHGDAAFAGQGVVFETMHLSDLPAYTTHGTIHIVANNQIGFTTDPRHSRSSAYCTDVARVVNAPIFHVNGDNPEAVMHVCNVAAEWRATFHKDVVIDIVSYRRNGHNEVDEPMFTQPLMYQKIRKTKPVLEKYADQLIAEGVVTAEEVKDVKDKYEKICEDAYNQAKQETHIKYKDWLDSPWSGFFEGKDPLKMSATGVVEETLVHIGRRFSSPPPNAAEFEIHKGLLRILKSRMEMVDNRTVDWALAEAMAYGSLLKEGIHVRLSGEDVERGTFSHRHHVLHHQKVDKATYCALAHLYPDQAPYTVCNSSLSEYGVLGFEVGYSVTNPNALVLWEAQFGDFNNVAQCIIDQFISSGQAKWVRQSGIVLLQPHGMEGMGPEHSSARLERFLQMCSDDPDYMPPESPDYEVRQLHDCNWIVANCSTPASYFHILRRQIALPFRKPLILMTPKSLLRHPECKSSFDDMKEGTNFKRVIPEEGPASENPQNVRKLAFCSGRVYYDLLKQRRDKGLEKDIAIARLEQISPFPYDQVKAEIAKYPNAQLVWSQEEHKNMGSWSYIEPRFRTLLQNQKQISYNGRATAASPATGSKAAHNKELRNLLEEFCVL

Summary

EMBL
RSAL01000018    RVE52834.1    KQ460883    KPJ11296.1    KQ459586    KPI97987.1    + More
BABH01036740    BABH01036741    BABH01036742    GECZ01026047    GECZ01008678    JAS43722.1    JAS61091.1    GFDL01002349    JAV32696.1    GANO01002076    JAB57795.1    KQ971342    EFA04760.2    FX983739    BAX07238.1    NEVH01021207    PNF19902.1    GFDL01007319    JAV27726.1    PNF19907.1    AAAB01008960    EAA44209.4    CVRI01000043    CRK95809.1    KYB27599.1    JR048976    AEY60821.1    GEDC01020146    JAS17152.1    CH477404    EAT41627.1    GFDL01002350    JAV32695.1    GFDL01007283    JAV27762.1    GAPW01000081    JAC13517.1    PNF19903.1    GEDC01014018    JAS23280.1    GFDL01002347    JAV32698.1    GL768221    EFZ11740.1    EDO63863.1    EDO63865.1    PNF19908.1    KK107109    EZA59108.1    CRK95807.1    GFDL01000431    JAV34614.1    EAT41628.1    KU932365    APA34001.1    DS235882    EEB20073.1    KK853114    KDR11185.1    EDO63864.1    GBHO01018812    GDHC01007131    JAG24792.1    JAQ11498.1    KQ981864    KYN34200.1    KQ979568    KYN20947.1    GBHO01018809    JAG24795.1    KQ976580    KYM79890.1    PNF19904.1    CRK95808.1    GL449033    EFN83427.1    GL888818    EGI57955.1    GDKW01000311    JAI56284.1    APCN01005863    GGFK01000424    MBW33745.1    QOIP01000008    RLU19242.1    GFDL01007204    JAV27841.1    KQ977104    KYN05775.1    GFDL01007259    JAV27786.1    DS231969    EDS29697.1    GFTR01008494    JAW07932.1    KQ435969    KOX67894.1    GGFM01006437    MBW27188.1    EDO63862.1    KZ288310    PBC28616.1    GEDC01022747    JAS14551.1    GBGD01000262    JAC88627.1    NNAY01000902    OXU26009.1    GBHO01018814    JAG24790.1    GECL01003201    JAP02923.1    GFDL01007348    JAV27697.1    KQ982335    KYQ57597.1    GEDC01019222    JAS18076.1    GDAI01002277    JAI15326.1    GBHO01018810    GBRD01008017    JAG24794.1    JAG57804.1    CRK95806.1    ADTU01014885    ADTU01014886    ADTU01014887    GBHO01021827    GBRD01008018    JAG21777.1    JAG57803.1    GFDF01001346    JAV12738.1    KF647632    AHB50494.1    GFXV01005053    MBW16858.1    KQ794714    OAD47021.1    CM002912    KMZ00162.1    GBHO01018807    JAG24797.1    AE014296    BT012466    AAN11721.1    AAO41241.2    AAS93737.1    KQ434786    KZC05090.1    KMZ00158.1    KMZ00169.1    GGMS01015849    MBY85052.1    ABLF02016166    CM000159    KRK02041.1    KRK02042.1    GEZM01046467    GEZM01046465    JAV77220.1    CH954178    KQS44070.1    KQS44072.1    GFDF01001330    JAV12754.1    CH933809    KRG06207.1    KMZ00159.1   
Pfam
PF02779   Transket_pyr        + More
PF00676   E1_dh
PF16078   2-oxogl_dehyd_N
PF16870   OxoGdeHyase_C
PF02099   Josephin
Interpro
IPR011603   2oxoglutarate_DH_E1        + More
IPR032106   2-oxogl_dehyd_N       
IPR029061   THDP-binding       
IPR042179   KGD_C_sf       
IPR031717   KGD_C       
IPR001017   DH_E1       
IPR005475   Transketolase-like_Pyr-bd       
IPR006155   Josephin       
SUPFAM
SSF52518   SSF52518       
Gene 3D
PDB
2JGD     E-value=0,     Score=1699

Ontologies

Topology

Length:
1021
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00373000000000001
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00017
outside
1  -  1021
 
 

Population Genetic Test Statistics

Pi
232.50422
Theta
174.211962
Tajima's D
1.20744
CLR
0.01981
CSRT
0.713264336783161
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31250652 GKREGYTAVLSIAAAKARRRAHGTDGSASSVTSSTTSKMEVDEEEKKPSKSPNITVHSKSDKDAPKDAKKDEKEAEDKEAKEKKEPEPTFEILSNPARVMRQQLKNLTIVEGSGFTPLKDITIGGIVMLNHTGEGEQVLVEPVAAFGPKAEEEKEPEPPEPFEYLDD 98.51 3e-32
28556443 VIPEEGPASENPQNVR 100.00 1e-14
28556443 QIALPFR 100.00 1e-14
28556443 NEVPLTSLVPSSGGMPSISAGSPINEK 100.00 3e-11
28556443 MSATGVVEETLVHIGR 100.00 3e-11
28556443 MSATGVVEETLVHIGR 100.00 3e-11
28556443 MSATGVVEETLVHIGR 100.00 3e-11
28556443 QIALPFR 100.00 2e-09
28556443 STGFENFLAK 100.00 2e-09
28556443 NEVPLTSLVPSSGGMPSISAGSPINEK 100.00 2e-07
28556443 NEVPLTSLVPSSGGMPSISAGSPINEK 100.00 2e-07
28556443 LAVCANPSHLEAVDPVVQGK 100.00 2e-07
28556443 IIDDHLAVQAIIR 100.00 2e-07
28556443 ICEDAYNQAK 100.00 2e-07
28556443 IIDDHLAVQAIIR 100.00 2e-07
28556443 YHLGTYIER 100.00 5e-07
28556443 VVNAPIFHVNGDNPEAVMHVCNVAAEWR 100.00 5e-07
28467696 RFPWGDGQK 100.00 2e-04
28556443 MSATGVVEETLVHIGR 100.00 3e-04
28556443 MSATGVVEETLVHIGR 100.00 3e-04
28556443 MSATGVVEETL 100.00 3e-04
28556443 MSATGVVEETLVHIGR 100.00 3e-04
28556443 LGVESIIMGMPHR 100.00 3e-04
28556443 LGVESIIMGMPHR 100.00 3e-04
31250652 AFANEAVIRQHGPEHSSAR 100.00 4e-04
26822097 IEQISPFPYDQVK 100.00 5e-04
26280517 VIIWGNHSSTQFPDASNAVAIVGGAQK 100.00 5e-04
25044914 VIPDVCGPPPIR 100.00 5e-04
28467696 VIPAQVPAAVPQIVPAPTCTHCHQPPATGTISR 100.00 5e-04
28556443 VIPEEGPASENPQNVR 100.00 5e-04
28556443 VIPEEGPASENPQNVR 100.00 5e-04
28556443 STGFENFLAK 100.00 5e-04
28556443 VIPEEGPASENPQNVR 100.00 5e-04
28556443 SSAYCTDVAR 100.00 5e-04
28556443 NGHNEVDEPMFTQPLMYQK 100.00 5e-04
28556443 SISAGSPINEK 100.00 6e-04
31250652 LGVESIIMGMPHRDVAR 100.00 6e-04
28556443 FGLEGCEILIPAMK 100.00 0.001
28556443 FDEADMDR 100.00 0.001
28556443 AFANEAVIR 100.00 0.001
28556443 TLLDETEER 100.00 0.001
26822097 STGFENFIAK 100.00 0.001
28467696 FSSCGGGGGSFGAGGGFGSR 100.00 0.001
28556443 FSSPPPNAAEFEIHK 100.00 0.001
28556443 FSSPPPNAAEFEIHK 100.00 0.001
28556443 FGLEGCEILIPAMK 100.00 0.001
28556443 FSSPPPNAAEFEIHK 100.00 0.001
28556443 FGLEGCEILIPAMK 100.00 0.001
28556443 YPNAQLVWSQEEHK 100.00 0.001
28467696 SSEISVPPPVIWAQR 100.00 0.002
28556443 YKDWLDSPWSGFFEGK 100.00 0.002
28556443 VIPEEGPASENPQNVR 100.00 0.002
26822097 YPNAQIVWSQEEHK 100.00 0.009
28556443 LEQISPFPYDQVK 100.00 0.017
28556443 LDPLEIANYDLGGK 100.00 0.017
28556443 LDPLEIANYDLGGK 100.00 0.017
28556443 LDPLEIANYDLGGK 100.00 0.017
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号