SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13211
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Extracellular   Reliability : 1.623 Mitochondrial   Reliability : 1.57
 

Sequence

CDS
ATGCTGGTTCCGAGGCTGATGGGGACGGCGGGTGCGCTGACCCGTCTTCTTCCCAACACCGGTGGATGCAGCGCCGGTATCCGGCGACTGTACCTGGGGGTGGTGCGCAGTATGGCCCTGTACGGTGCTCCCGTGTGGTCGCCCGCACTTACCGCGCGAAACGCGGCTCTGCTGCTCAGAGCTCAGCGGGCGCTCGCGGTGAGGGTTATCAGGGGGTACCGCACCATATCTCAGGATGTGGCCTGTGCTCTCGCCGGATCCTTACCGTGGGACCTCGAGGCCGAAATCTTGGCCACGACATACCGACGGAGAACACAGTCCTCGACTCGGGAACGGACACCCGGCCCGTCGGTTGTCGATCGATGGAGGCGTGCTGCGCGTGGTCTGGCGTATGCCAAATGGAGAGAGCGGTTGCTGGAGGAGCTCGGCCGAACTTCGGCCACTCGTCAGCGCACGCTCGAGGCACTGGTGTCTGTGCTGGAGGCATGGTCGGACCGGCGACACGGTGAGCTCTCCTTTCGCCTCACCCAGGTCCTCTCAGGGCATGGATGCTTCGGGAGGTATCTGTGGAGAGTCTGCGGAAGGGAGCCACATCCGGGCTGCCACCAGTGCGGGCACCCGAACGATGACGCTCAGCACGCGCTAGAAGCGTGCCCACGGTGGGAGCACCCGCGGCGAAACCTCGTCGCGGTGTTGGGGCAGGACCTCTCTTTGCGGGCTATCGTCGCCCGTATGGTAGAGGACCGGAGTTCGTGGGAGGCCATGACTGGGTTCTGTGACTTGGTCATGGCGCTTCGTGAGGCTGAGGAGCGCGAAAGGGAACGGGATCCCTCTTCGGCTCCTCAGCGCAGAAGGCGGGGTGGACGGCGCGTGCGAGAGGCCGCCGCTCAGCCCTCGTAG
Protein
MLVPRLMGTAGALTRLLPNTGGCSAGIRRLYLGVVRSMALYGAPVWSPALTARNAALLLRAQRALAVRVIRGYRTISQDVACALAGSLPWDLEAEILATTYRRRTQSSTRERTPGPSVVDRWRRAARGLAYAKWRERLLEELGRTSATRQRTLEALVSVLEAWSDRRHGELSFRLTQVLSGHGCFGRYLWRVCGREPHPGCHQCGHPNDDAQHALEACPRWEHPRRNLVAVLGQDLSLRAIVARMVEDRSSWEAMTGFCDLVMALREAEERERERDPSSAPQRRRRGGRRVREAAAQPS

Summary

EMBL
D85594    BAA19776.1    RSAL01000481    RVE41577.1    KZ150308    PZC71477.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078935    BAC06462.1    AB126050    BAD86650.1    AB078929    BAC06452.1    AB090825    BAC57926.1    KZ150386    PZC71062.1    KZ149896    PZC78733.1    KZ149950    PZC76665.1    LBMM01012027    KMQ86470.1    LBMM01009501    KMQ88083.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    ODYU01009945    SOQ54696.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01003679    KMQ93242.1    LBMM01006909    KMQ90209.1    QOIP01000010    RLU18098.1    GBHO01002982    JAG40622.1    LBMM01006954    KMQ90166.1    LBMM01005733    KMQ91252.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GFXV01002242    MBW14047.1    QOIP01000031    RLU14697.1    GGMR01004600    MBY17219.1    GGMR01012534    MBY25153.1    LBMM01015018    KMQ84954.1    KQ460685    KPJ12887.1    LBMM01008349    KMQ88951.1    LBMM01004505    KMQ92346.1    GGMR01014918    MBY27537.1    GAPW01002043    JAC11555.1    KQ414641    KOC66782.1    GFXV01003903    MBW15708.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    ABLF02009991    ABLF02009992    ABLF02054952    GGMR01005740    MBY18359.1    GGMR01011974    MBY24593.1    ABLF02059310    ABLF02041886    ABLF02018942    ABLF02041885    GGMS01001211    MBY70414.1    ABLF02016435    ABLF02016436    ABLF02064751    ABLF02017307    ABLF02011183    ABLF02041884    LBMM01005216    KMQ91703.1    GGMR01006838    MBY19457.1    GGMR01006977    MBY19596.1    LBMM01015025    KMQ84953.1    ABLF02023401    ABLF02029423    ABLF02060278    GAPW01002123    JAC11475.1    GAPW01002021    JAC11577.1    GALX01004785    JAB63681.1    ABLF02006132    GAKP01002292    JAC56660.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    KQ972691    KXZ75805.1    LBMM01003245    KMQ93755.1    AAZX01012143    AAZX01012194    AB593326    BAK38647.1    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1    AB593322    BAK38641.1    LBMM01006110    KMQ90925.1    GGFL01001583    MBW65761.1    LBMM01012595    KMQ86127.1    GEHC01000964    JAV46681.1    GAPW01002982    JAC10616.1    GGMR01015518    MBY28137.1    GGMS01012210    MBY81413.1    LBMM01020849    KMQ83202.1    GFTR01007160    JAW09266.1    CH963857    KRF98317.1    KU543679    AMS38363.1    GGFJ01001370    MBW50511.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
299
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.48957
Exp number, first 60 AAs:
0.48742
Total prob of N-in:
0.02941
outside
1  -  299
 
 

Population Genetic Test Statistics

Pi
38.613355
Theta
55.994024
Tajima's D
1.238146
CLR
0.82935
CSRT
0.725563721813909
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号